G433583


Basic Information

Item Value
gene id G433583
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 5673412 ~ 5673651 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU497833
CCAGGTCTTCGTTCATCATGTCTGGTCTTTTGGGTCTTTAACTGTAAAATTCCCGTAGAGTGTAATCTGGATAAATGTCATGTGCAACATCCTGGCAACCATCCAGAACACTCTAGCATCATAACAGCTGGTGTTCTACAGAACTTGCTGTTTCATTAATATAAAACCTTTCTAAACTATACATATGCTAATTTAAGCAGAAAATATGTTACACAACGAGTGAGACTCATTTAATGGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU497833 True 240 lncRNA 0.37 1 5673412 5673651

Neighbor

gene id symbol gene type direction distance location
CI01000306_05664945_05673274 ACE2 coding downstream 114 5664945 ~ 5673298 (-)
CI01000306_05631903_05640235 NA coding downstream 33177 5631733 ~ 5640235 (-)
CI01000306_05619706_05631189 PIR coding downstream 42223 5619636 ~ 5631189 (-)
CI01000306_05606914_05611346 FIGF, VEGFD coding downstream 62066 5606605 ~ 5611346 (-)
CI01000306_05555926_05562924 XK coding downstream 110463 5555926 ~ 5562949 (-)
CI01000306_05732360_05733779 NA coding upstream 57632 5731283 ~ 5735848 (-)
CI01000306_05760131_05782175 SCML2 coding upstream 85683 5759334 ~ 5782175 (-)
CI01000306_05879886_05883498 NA coding upstream 205087 5878738 ~ 5884232 (-)
CI01000306_05888356_05890267 TMEM169A coding upstream 214418 5888069 ~ 5890366 (-)
CI01000306_05891607_05897232 PECR coding upstream 217922 5891573 ~ 5897325 (-)
G433561 NA non-coding downstream 82849 5567915 ~ 5590563 (-)
G433518 NA non-coding downstream 109743 5563418 ~ 5563669 (-)
G433550 NA non-coding downstream 147060 5525168 ~ 5526352 (-)
G433527 NA non-coding downstream 155033 5517830 ~ 5518379 (-)
CI01000306_05506906_05508492 NA non-coding downstream 165063 5506132 ~ 5508657 (-)
G433595 NA non-coding upstream 84547 5758198 ~ 5815869 (-)
G433617 NA non-coding upstream 114082 5787733 ~ 5788071 (-)
G433593 NA non-coding upstream 115164 5788815 ~ 5792231 (-)
G433656 NA non-coding upstream 176107 5849758 ~ 5852399 (-)
G433628 NA non-coding upstream 211552 5885203 ~ 5887132 (-)
G433450 NA other downstream 289649 5361643 ~ 5383763 (-)
CI01000306_04544349_04545034 NA other downstream 1128320 4542723 ~ 4545244 (-)
G432022 NA other downstream 2669521 3000236 ~ 3003891 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 3924462 1717933 ~ 1726043 (-)
G431814 NA other downstream 4360978 1311702 ~ 1312434 (-)
G433670 NA other upstream 367363 6041014 ~ 6041283 (-)
G433985 NA other upstream 522456 6196107 ~ 6197210 (-)
G434016 NA other upstream 681529 6355180 ~ 6361643 (-)
G434086 NA other upstream 763755 6437406 ~ 6452251 (-)
G434338 NA other upstream 1193005 6866656 ~ 6866936 (-)

Expression


Co-expression Network