G433595


Basic Information

Item Value
gene id G433595
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 5758198 ~ 5815869 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU497862
AGATTAACGAAGGTCTTACGGGTCTGGAACGGCATGAGGGTGAGTAATAAATGACATTATTTTCATTTTTGGGTGAACTAACCCTTTAAGCCCTGAGGGTATTTTCAGAGTTGTTGTTTTTTTCTGAGTGAAACACAAAGTAAAGACTCGAAACTCAAACTATAGCAAGGAGAGTCAAAAGGTTGGTATCGTTTGAAAGGAAACTTTTTAAATTTTTAAATAAAAAAAAATAAAATTTGGACATTCTCATGCTGAGAAACTGGAGAGAAAAAAAAAATCTTTACATATCTTTCTAATGTAAAATGGAATATCTCATGAAGGATATCTCATAGCTGGATCATTTTTTTTTTGCTGATGTTCCTCTATATGTGAGCTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU497862 True 377 lncRNA 0.33 2 5758198 5815869

Neighbor

gene id symbol gene type direction distance location
CI01000306_05732360_05733779 NA coding downstream 22350 5731283 ~ 5735848 (-)
CI01000306_05664945_05673274 ACE2 coding downstream 84900 5664945 ~ 5673298 (-)
CI01000306_05631903_05640235 NA coding downstream 117963 5631733 ~ 5640235 (-)
CI01000306_05619706_05631189 PIR coding downstream 127009 5619636 ~ 5631189 (-)
CI01000306_05606914_05611346 FIGF, VEGFD coding downstream 146852 5606605 ~ 5611346 (-)
CI01000306_05879886_05883498 NA coding upstream 62869 5878738 ~ 5884232 (-)
CI01000306_05888356_05890267 TMEM169A coding upstream 72200 5888069 ~ 5890366 (-)
CI01000306_05891607_05897232 PECR coding upstream 75704 5891573 ~ 5897325 (-)
CI01000306_05902120_05929983 MAP4K3A coding upstream 85929 5901798 ~ 5929983 (-)
CI01000306_05990444_06033972 NCX, SLC8A1, SLC8A1A, SLC8A1B coding upstream 173384 5989253 ~ 6033972 (-)
G433583 NA non-coding downstream 84547 5673412 ~ 5673651 (-)
G433561 NA non-coding downstream 167635 5567915 ~ 5590563 (-)
G433518 NA non-coding downstream 194529 5563418 ~ 5563669 (-)
G433550 NA non-coding downstream 231846 5525168 ~ 5526352 (-)
G433527 NA non-coding downstream 239819 5517830 ~ 5518379 (-)
G433656 NA non-coding upstream 33889 5849758 ~ 5852399 (-)
G433628 NA non-coding upstream 69334 5885203 ~ 5887132 (-)
G433633 NA non-coding upstream 195790 6011659 ~ 6028057 (-)
G433940 NA non-coding upstream 235936 6051805 ~ 6054634 (-)
G433939 NA non-coding upstream 287970 6103839 ~ 6107564 (-)
G433450 NA other downstream 374435 5361643 ~ 5383763 (-)
CI01000306_04544349_04545034 NA other downstream 1213106 4542723 ~ 4545244 (-)
G432022 NA other downstream 2754307 3000236 ~ 3003891 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 4009248 1717933 ~ 1726043 (-)
G431814 NA other downstream 4445764 1311702 ~ 1312434 (-)
G433670 NA other upstream 225145 6041014 ~ 6041283 (-)
G433985 NA other upstream 380238 6196107 ~ 6197210 (-)
G434016 NA other upstream 539311 6355180 ~ 6361643 (-)
G434086 NA other upstream 621537 6437406 ~ 6452251 (-)
G434338 NA other upstream 1050787 6866656 ~ 6866936 (-)

Expression


Co-expression Network