G433948


Basic Information

Item Value
gene id G433948
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 6138677 ~ 6139696 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU498244
GGCAGCATCAAGCAGGGGCCAGTGAAGGAGCCATCACTACCATATAACATATTACAAATCTGTACCTGTTCCCAGGGGACCTCGTGTCTGGATTTAGTAAAGGATATGGCCATTCGGTGATCTTTTTGGCGTATTTTCGGATTATGTTGTCTTCACTGAAGAGAAACAGAGAGCGGTTGACCGTCAGGCAGTTCTGTCGGACCGGGATCGGGTTGTAGAGGGCCATGGTCCGGGCTCTCTGGGCCATCGATTGCTTGTACATCCTCTGGGCCCCTGGCGGGCCGCCCTGCCTGCTGCCGCCGCGGCCGGGTCCCCCCTGAACGGAGCCCCCGCCGCCGTACCTGGCCGGCACTTCGTCTCCGAACCGAGCCATTCTTTTAATTATTAATTTATTTCTGTGGTATCCGCAATGTTTGGTATACTATGGCAATATTCAGACTCCCCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU498244 True 446 lncRNA 0.54 2 6138677 6139696

Neighbor

gene id symbol gene type direction distance location
CI01000306_06108667_06110250 NA coding downstream 28427 6108258 ~ 6110250 (-)
CI01000306_06048083_06049632 NA coding downstream 89045 6047839 ~ 6049632 (-)
CI01000306_05990444_06033972 NCX, SLC8A1, SLC8A1A, SLC8A1B coding downstream 104705 5989253 ~ 6033972 (-)
CI01000306_05902120_05929983 MAP4K3A coding downstream 208694 5901798 ~ 5929983 (-)
CI01000306_05891607_05897232 PECR coding downstream 241352 5891573 ~ 5897325 (-)
CI01000306_06244021_06244397 NA coding upstream 104239 6243935 ~ 6244397 (-)
CI01000306_06253870_06254391 NA coding upstream 113650 6253346 ~ 6256066 (-)
CI01000306_06273326_06277287 NACC1 coding upstream 132719 6272415 ~ 6277442 (-)
CI01000306_06289571_06299875 MAN2B1 coding upstream 149452 6289148 ~ 6300251 (-)
CI01000306_06336883_06339725 NA coding upstream 196955 6336651 ~ 6341662 (-)
G433939 NA non-coding downstream 31113 6103839 ~ 6107564 (-)
G433940 NA non-coding downstream 84043 6051805 ~ 6054634 (-)
G433633 NA non-coding downstream 110620 6011659 ~ 6028057 (-)
G433628 NA non-coding downstream 251545 5885203 ~ 5887132 (-)
G433656 NA non-coding downstream 286278 5849758 ~ 5852399 (-)
G434001 NA non-coding upstream 117309 6257005 ~ 6257347 (-)
G434064 NA non-coding upstream 266829 6406525 ~ 6406767 (-)
G434073 NA non-coding upstream 274057 6413753 ~ 6414174 (-)
G434079 NA non-coding upstream 286014 6425710 ~ 6425956 (-)
G433670 NA other downstream 97394 6041014 ~ 6041283 (-)
G433450 NA other downstream 754914 5361643 ~ 5383763 (-)
CI01000306_04544349_04545034 NA other downstream 1593585 4542723 ~ 4545244 (-)
G432022 NA other downstream 3134786 3000236 ~ 3003891 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 4389727 1717933 ~ 1726043 (-)
G433985 NA other upstream 56411 6196107 ~ 6197210 (-)
G434016 NA other upstream 215484 6355180 ~ 6361643 (-)
G434086 NA other upstream 297710 6437406 ~ 6452251 (-)
G434338 NA other upstream 726960 6866656 ~ 6866936 (-)
G436446 NA other upstream 3516583 9656279 ~ 9671776 (-)

Expression


Co-expression Network