G434681


Basic Information

Item Value
gene id G434681
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 7244008 ~ 7244315 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU499032
TTTTGATTGGTTCTTGTTTTGTTAGTGCTGTTTGTTGTGATAGTCATGTGCTCCCCAGTGCCATTGATTTAGTAGGGCTGGGACAATAAATCATTGCAATAAATCGAGAAATGGTTCTGGATTGATTCTGAGATTTTCCGAATGTATCGCAATTCTCTCTCGAATCGATTCTGTTTTTAACAGCAGATGGCACTGCGTGCTTTAGAAACAGCCATACTCTGGTTGCTTCCAATTCCTTTCACACACCAGTTGAACCTTCTATAAAATAATCATTCAAAAAGTTCGAAAAGGTTGAAGCGAATTACAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU499032 True 308 lncRNA 0.38 1 7244008 7244315

Neighbor

gene id symbol gene type direction distance location
CI01000306_06998286_07073243 PCDH17 coding downstream 170765 6998286 ~ 7073243 (-)
CI01000306_06815523_06829337 NA coding downstream 414492 6815441 ~ 6829516 (-)
CI01000306_06780961_06789374 NA coding downstream 454414 6780773 ~ 6789594 (-)
CI01000306_06776313_06778496 NA coding downstream 465312 6776114 ~ 6778815 (-)
CI01000306_06741870_06743844 NA coding downstream 500066 6741859 ~ 6743942 (-)
CI01000306_07331303_07340271 NA coding upstream 86637 7330952 ~ 7341271 (-)
CI01000306_07561305_07566290 LIMS1 coding upstream 316236 7560551 ~ 7566933 (-)
CI01000306_07680537_07684881 NXPH2B coding upstream 435553 7679868 ~ 7685987 (-)
CI01000306_07687805_07693178 NA coding upstream 443291 7687606 ~ 7693178 (-)
CI01000306_07694770_07711329 PHKA2 coding upstream 450377 7694692 ~ 7712134 (-)
G434611 NA non-coding downstream 39030 7198106 ~ 7204978 (-)
G434598 NA non-coding downstream 56867 7186712 ~ 7187141 (-)
G434597 NA non-coding downstream 57348 7186427 ~ 7186660 (-)
G434579 NA non-coding downstream 77013 7166795 ~ 7166995 (-)
G434548 NA non-coding downstream 123352 7120226 ~ 7120656 (-)
G434686 NA non-coding upstream 11653 7255968 ~ 7256267 (-)
G434673 NA non-coding upstream 13780 7258095 ~ 7258435 (-)
G434690 NA non-coding upstream 21599 7265914 ~ 7266253 (-)
G434716 NA non-coding upstream 34701 7279016 ~ 7279280 (-)
G434747 NA non-coding upstream 66499 7310814 ~ 7311045 (-)
G434338 NA other downstream 377072 6866656 ~ 6866936 (-)
G434086 NA other downstream 791757 6437406 ~ 6452251 (-)
G434016 NA other downstream 882365 6355180 ~ 6361643 (-)
G433985 NA other downstream 1046798 6196107 ~ 6197210 (-)
G433670 NA other downstream 1202725 6041014 ~ 6041283 (-)
G436446 NA other upstream 2411964 9656279 ~ 9671776 (-)
G436626 NA other upstream 2590710 9835025 ~ 9836323 (-)
G436643 NA other upstream 2777833 10022148 ~ 10025375 (-)

Expression


Co-expression Network