G434923



Basic Information


Item Value
gene id G434923
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 7552312 ~ 7552557 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU499285
GTGACACCCTTACTGTTAACATAAGAATTAAGAGGGTAAGTAGCAGTCAGGCACTGCTAATCAAATACCTTTGATTAATTGATCATCAGCAAGTGTGAGCACCTCTATAAAATCAGAAGTTTTGGCAGTTTGCTTGTCTGGTGCATTCAGGTGTGTGTTAACACAATGCCAAGGAGGAAAGACATCAGCAATGATTTTAGAGAAGCAATTGTTACTGCCATCAATCTGAGAAGGGTTATATGGCCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU499285 True 246 lncRNA 0.40 1 7552312 7552557
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000306_07492176_07535995 CNTNAP5L coding upstream 15356 7490293 ~ 7536956 (+)
CI01000306_07386318_07389827 NKPD1 coding upstream 162272 7386318 ~ 7390040 (+)
CI01000306_06722271_06723631 NA coding upstream 828404 6722271 ~ 6723908 (+)
CI01000306_06592383_06685440 DIAPH3 coding upstream 866872 6592383 ~ 6685440 (+)
CI01000306_06564978_06573507 NA coding upstream 978521 6564978 ~ 6573791 (+)
CI01000306_07559884_07560060 NA coding downstream 7327 7559884 ~ 7560100 (+)
CI01000306_07609108_07637728 NA coding downstream 56551 7609108 ~ 7637836 (+)
CI01000306_07640049_07676915 SPOPLB, SPOPL, SPOPLA coding downstream 87492 7640049 ~ 7677784 (+)
CI01000306_07836379_07838734 NA coding downstream 283788 7836345 ~ 7838939 (+)
CI01000306_07864325_07865368 MGC80983, FAM43A, FAM43A.L coding downstream 311535 7864092 ~ 7866319 (+)
G434916 NA non-coding upstream 69810 7481911 ~ 7482502 (+)
G434723 NA non-coding upstream 257694 7294414 ~ 7294618 (+)
G434698 NA non-coding upstream 281311 7270701 ~ 7271001 (+)
G434662 NA non-coding upstream 294137 7257953 ~ 7258175 (+)
G434661 NA non-coding upstream 294386 7257657 ~ 7257926 (+)
G434940 NA non-coding downstream 192217 7744774 ~ 7781940 (+)
G435001 NA non-coding downstream 238683 7791240 ~ 7791486 (+)
G435002 NA non-coding downstream 246801 7799358 ~ 7799568 (+)
G435009 NA non-coding downstream 249704 7802261 ~ 7813837 (+)
G435011 NA non-coding downstream 265643 7818200 ~ 7821142 (+)
G434545 NA other upstream 432453 7119317 ~ 7119859 (+)
G433724 NA other upstream 1422534 6108611 ~ 6129778 (+)
CI01000306_06106248_06107449 GM2573, CS056, WDR83OS other upstream 1444137 6106143 ~ 6108175 (+)
CI01000306_05976516_05985251 TMEM178A, TMEM178 other upstream 1566024 5975822 ~ 5986288 (+)
G432958 NA other upstream 1892143 5658928 ~ 5660169 (+)
CI01000306_09225597_09230504 NA other downstream 1673008 9225512 ~ 9231333 (+)
CI01000306_09263755_09288503 NA other downstream 1721342 9263589 ~ 9289035 (+)
G435590 NA other downstream 2160292 9704707 ~ 9737144 (+)
CI01000306_09860935_09865155 SH2D5 other downstream 2307656 9860480 ~ 9865724 (+)
G435639 NA other downstream 2327363 9878664 ~ 9884919 (+)

Expression


G434923 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G434923 Expression in each Bioproject

Bar chart with 42 bars.
G434923 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G193731 NA non-coding NW_025048756.1 JAEQBD010001102.1 1030320 ~ 1036282 (+)