G435009


Basic Information

Item Value
gene id G435009
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 7802261 ~ 7813837 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU499378
TGTATCCTAGAGAACTGCAGATATGACATACAGATGACATGAACATGGCCCCAGTTTTGGAAAACTAATTTTTCAGCACATATATGATTGCTATGGAACTTAAAGGGATAGTACACACAAAAATGAAAATTCTGTCATCATTTACTCAACCAAGTTGCTGGTCCCCATTGACTTCCAGAGTATTATGGAAGTCAATAGGGACCAGCAACTCTTCGGTTACCCACATTCTTCAAAATATCTTCTTTTGTGCTCAATAGAACAAAGAAATTCATACATGTTTTGAACAACTTAAGGGTTTCATTTTTGGGTGAACTATCCCTTTAAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU499378 True 326 lncRNA 0.37 2 7802261 7813837

Neighbor

gene id symbol gene type direction distance location
CI01000306_07640049_07676915 SPOPLB, SPOPL, SPOPLA coding upstream 124477 7640049 ~ 7677784 (+)
CI01000306_07609108_07637728 NA coding upstream 164425 7609108 ~ 7637836 (+)
CI01000306_07559884_07560060 NA coding upstream 242161 7559884 ~ 7560100 (+)
CI01000306_07492176_07535995 CNTNAP5L coding upstream 265305 7490293 ~ 7536956 (+)
CI01000306_07386318_07389827 NKPD1 coding upstream 412221 7386318 ~ 7390040 (+)
CI01000306_07836379_07838734 NA coding downstream 22508 7836345 ~ 7838939 (+)
CI01000306_07864325_07865368 MGC80983, FAM43A, FAM43A.L coding downstream 50255 7864092 ~ 7866319 (+)
CI01000306_08022902_08036910 ZMAT3 coding downstream 207559 8021396 ~ 8037025 (+)
CI01000306_08131828_08140454 NA coding downstream 317696 8131533 ~ 8141844 (+)
CI01000306_08178823_08206611 SLC38A3 coding downstream 364986 8178823 ~ 8207112 (+)
G435002 NA non-coding upstream 2693 7799358 ~ 7799568 (+)
G435001 NA non-coding upstream 10775 7791240 ~ 7791486 (+)
G434940 NA non-coding upstream 20321 7744774 ~ 7781940 (+)
G434923 NA non-coding upstream 249704 7552312 ~ 7552557 (+)
G434916 NA non-coding upstream 319759 7481911 ~ 7482502 (+)
G435011 NA non-coding downstream 4363 7818200 ~ 7821142 (+)
G435027 NA non-coding downstream 35460 7849297 ~ 7854339 (+)
G435028 NA non-coding downstream 44037 7857874 ~ 7858448 (+)
G435049 NA non-coding downstream 68933 7882770 ~ 7882983 (+)
G435050 NA non-coding downstream 69244 7883081 ~ 7883282 (+)
G434545 NA other upstream 682402 7119317 ~ 7119859 (+)
G433724 NA other upstream 1672483 6108611 ~ 6129778 (+)
CI01000306_06106248_06107449 GM2573, CS056, WDR83OS other upstream 1694086 6106143 ~ 6108175 (+)
CI01000306_05976516_05985251 TMEM178A, TMEM178 other upstream 1815973 5975822 ~ 5986288 (+)
G432958 NA other upstream 2142092 5658928 ~ 5660169 (+)
CI01000306_09225597_09230504 NA other downstream 1411728 9225512 ~ 9231333 (+)
CI01000306_09263755_09288503 NA other downstream 1460062 9263589 ~ 9289035 (+)
G435590 NA other downstream 1899012 9704707 ~ 9737144 (+)
CI01000306_09860935_09865155 SH2D5 other downstream 2046376 9860480 ~ 9865724 (+)
G435639 NA other downstream 2066083 9878664 ~ 9884919 (+)

Expression


Co-expression Network