G435438


Basic Information

Item Value
gene id G435438
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9089055 ~ 9089347 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU499831
ACATCATTAAAGTAATCCATGTGACTCAGTGGTTTACCCTCAATTTTATGAAGCGATGCAAGTGCTTTTTTTGCACACACACACACAAAAAAAAACATAATTTACCACTTTATTTACAAAATTATTGACCTGCAATCCAGCAGGGGGAGCGCTACGACACATGCGCTTTGTGTTGACTCAAGACTGGAAGTTGTTCTGTGAATGCGATTTGGATAATATTATTTTGTAACTATAGAGGTAAATTATGTTTGCTCTTGCGTTGCTTCATAAAATTGAGGGTAAACCACTGGAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU499831 True 293 lncRNA 0.37 1 9089055 9089347

Neighbor

gene id symbol gene type direction distance location
CI01000306_09081250_09087963 LDLRAD2 coding upstream 657 9081250 ~ 9088398 (+)
CI01000306_09049143_09051379 CYB561D1 coding upstream 37207 9049143 ~ 9051848 (+)
CI01000306_09034546_09046916 ATXN7L2, ATXN7L2A coding upstream 42111 9034439 ~ 9046944 (+)
CI01000306_09021191_09031657 SYPL2A coding upstream 57398 9021059 ~ 9031657 (+)
CI01000306_08984163_08984476 NA coding upstream 104351 8984163 ~ 8984704 (+)
CI01000306_09125548_09137714 NA coding downstream 35704 9125051 ~ 9137754 (+)
CI01000306_09141075_09152779 NA coding downstream 51555 9140902 ~ 9152819 (+)
CI01000306_09155525_09189777 NA coding downstream 66003 9155350 ~ 9190162 (+)
CI01000306_09195793_09213433 NA coding downstream 104870 9194217 ~ 9214865 (+)
CI01000306_09216004_09219290 NA coding downstream 126482 9215829 ~ 9219563 (+)
G435409 NA non-coding upstream 218178 8870560 ~ 8870877 (+)
G435408 NA non-coding upstream 218672 8870176 ~ 8870383 (+)
G435345 NA non-coding upstream 219231 8868477 ~ 8869824 (+)
G435407 NA non-coding upstream 227804 8861002 ~ 8861251 (+)
G435406 NA non-coding upstream 228177 8860662 ~ 8860878 (+)
G435446 NA non-coding downstream 29828 9119175 ~ 9119512 (+)
G435447 NA non-coding downstream 60573 9149920 ~ 9150238 (+)
G435451 NA non-coding downstream 69105 9176768 ~ 9177266 (+)
CI01000306_09248061_09260369 NA non-coding downstream 157990 9247797 ~ 9260408 (+)
G434545 NA other upstream 1969196 7119317 ~ 7119859 (+)
G433724 NA other upstream 2959277 6108611 ~ 6129778 (+)
CI01000306_06106248_06107449 GM2573, CS056, WDR83OS other upstream 2980880 6106143 ~ 6108175 (+)
CI01000306_05976516_05985251 TMEM178A, TMEM178 other upstream 3102767 5975822 ~ 5986288 (+)
G432958 NA other upstream 3428886 5658928 ~ 5660169 (+)
CI01000306_09225597_09230504 NA other downstream 136218 9225512 ~ 9231333 (+)
CI01000306_09263755_09288503 NA other downstream 184552 9263589 ~ 9289035 (+)
G435590 NA other downstream 623502 9704707 ~ 9737144 (+)
CI01000306_09860935_09865155 SH2D5 other downstream 770866 9860480 ~ 9865724 (+)
G435639 NA other downstream 790573 9878664 ~ 9884919 (+)

Expression


Co-expression Network