G436458


Basic Information

Item Value
gene id G436458
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9583606 ~ 9585632 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU501000
GCTGCTTTACTGTAAGGAAGGCCCATAATCTTTCAGTAAAGTTCGCCTGTCCAGGTCTGTCACTGTTTTGTTTCTGTATAGGTACACTAATTTGATACACCATTTTAGTTTTTTTCCGATAATGCAGAGACTTCAGTGGTGAACATTTTCAAACTGTTATCAATGATACGACCAGCCACCACAATCTCAGAACCGCTGTAGTACTGGCTAAAAGTGTTTTGGGTTACATCGTCCACTCCTTGGTAGCTAAGCTCGACATCAGTCAAGAGTGGAGTGGACACTCCCTTGTAGAAGTCCTACCAGAATAAAATTGTTTCTGTATATATTGTATTTACACAATTCAAGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU501000 True 347 lncRNA 0.40 2 9583606 9585632

Neighbor

gene id symbol gene type direction distance location
CI01000306_09522093_09523814 NINJ1 coding downstream 58053 9522033 ~ 9525553 (-)
CI01000306_09381571_09461159 CACNA1DA, CACNA1D coding downstream 122033 9381187 ~ 9461573 (-)
CI01000306_09374084_09380300 NA coding downstream 203100 9373287 ~ 9380506 (-)
CI01000306_09309973_09348444 CACNA2D3 coding downstream 235162 9309973 ~ 9348444 (-)
CI01000306_09290422_09292579 NA coding downstream 290787 9290104 ~ 9292819 (-)
CI01000306_09628418_09641286 NA coding upstream 42189 9627821 ~ 9641286 (-)
CI01000306_09690177_09739046 ERC2 coding upstream 104302 9689934 ~ 9739046 (-)
CI01000306_09753380_09774568 NA coding upstream 166736 9752368 ~ 9774784 (-)
CI01000306_09801952_09806496 BSNB coding upstream 216315 9801947 ~ 9808800 (-)
CI01000306_09825468_09827244 NA coding upstream 238943 9824575 ~ 9827282 (-)
G436603 NA non-coding downstream 6367 9576248 ~ 9577239 (-)
G436476 NA non-coding downstream 21001 9505648 ~ 9562605 (-)
G436451 NA non-coding downstream 33796 9547709 ~ 9549810 (-)
G436469 NA non-coding downstream 186867 9332973 ~ 9396739 (-)
G436495 NA non-coding downstream 295416 9286160 ~ 9288190 (-)
G436455 NA non-coding upstream 7225 9592857 ~ 9593480 (-)
G436442 NA non-coding upstream 8301 9593933 ~ 9595287 (-)
G436449 NA non-coding upstream 15717 9601349 ~ 9623391 (-)
G436437 NA non-coding upstream 16252 9601884 ~ 9612120 (-)
G436605 NA non-coding upstream 16762 9602394 ~ 9603376 (-)
G434338 NA other downstream 2716670 6866656 ~ 6866936 (-)
G434086 NA other downstream 3131355 6437406 ~ 6452251 (-)
G434016 NA other downstream 3221963 6355180 ~ 6361643 (-)
G433985 NA other downstream 3386396 6196107 ~ 6197210 (-)
G433670 NA other downstream 3542323 6041014 ~ 6041283 (-)
G436446 NA other upstream 70647 9656279 ~ 9671776 (-)
G436626 NA other upstream 249393 9835025 ~ 9836323 (-)
G436643 NA other upstream 436516 10022148 ~ 10025375 (-)

Expression


Co-expression Network