G435540


Basic Information

Item Value
gene id G435540
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9602427 ~ 9603396 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU499959
CGCATGATGTGGTCAGGAGTTTAAAGGAGTGTGCATTTCGAGGTCTGTTTTCTGAGCAGGTCATGATGGATCGAGCAGCTCTCAGACTGATTCTCTTGAGCGTCTTTCTCATCTCAGCCAGTTCACAACCTGTTAAGAAGAAACAAGATGTGGATATATACAGCTTCTACATTAACTCCACGGTCACCAGTCGCTACGCCACAACGGTCATCACAAGCCGTGTGGCGAACACNN

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU499959 True 234 lncRNA 0.47 2 9602427 9603396

Neighbor

gene id symbol gene type direction distance location
CI01000306_09559074_09602026 NA coding upstream 181 9558978 ~ 9602246 (+)
CI01000306_09548430_09553502 WNK2 coding upstream 48925 9548430 ~ 9553502 (+)
CI01000306_09536090_09548281 NA coding upstream 54146 9533915 ~ 9548281 (+)
CI01000306_09518431_09519858 CARD19 coding upstream 81707 9517962 ~ 9520720 (+)
CI01000306_09500798_09514840 BICD2 coding upstream 87106 9500475 ~ 9515321 (+)
CI01000306_09625036_09626067 NA coding downstream 21564 9624960 ~ 9626941 (+)
CI01000306_09656951_09671072 NA coding downstream 51999 9655395 ~ 9671766 (+)
CI01000306_09674684_09680504 CRELD1 coding downstream 69379 9672775 ~ 9680673 (+)
CI01000306_09851578_09857742 HP1BP3 coding downstream 247831 9851227 ~ 9858552 (+)
CI01000306_09860935_09865155 SH2D5 coding downstream 257539 9860480 ~ 9865724 (+)
G435554 NA non-coding upstream 122334 9436545 ~ 9480093 (+)
CI01000306_09296908_09305617 NA non-coding upstream 296260 9296809 ~ 9306977 (+)
CI01000306_09263755_09288503 NA non-coding upstream 313865 9263589 ~ 9289035 (+)
CI01000306_09216004_09219290 NA non-coding upstream 346737 9215829 ~ 9219563 (+)
CI01000306_09248061_09260369 NA non-coding upstream 351894 9247797 ~ 9260408 (+)
G435589 NA non-coding downstream 94033 9697429 ~ 9698325 (+)
G435590 NA non-coding downstream 101311 9704707 ~ 9737144 (+)
G435609 NA non-coding downstream 142438 9745834 ~ 9748829 (+)
G435637 NA non-coding downstream 274244 9877640 ~ 9877881 (+)
CI01000306_09225597_09230504 NA other upstream 375921 9225512 ~ 9231333 (+)
G434545 NA other upstream 2482568 7119317 ~ 7119859 (+)
G433724 NA other upstream 3472649 6108611 ~ 6129778 (+)
CI01000306_06106248_06107449 GM2573, CS056, WDR83OS other upstream 3494252 6106143 ~ 6108175 (+)
G435639 NA other downstream 276524 9878664 ~ 9884919 (+)
CI01000306_09891658_09893015 SNRPE other downstream 288136 9891532 ~ 9893239 (+)
G436932 NA other downstream 1479592 11082988 ~ 11098376 (+)

Expression


Co-expression Network