G436669



Basic Information


Item Value
gene id G436669
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9903196 ~ 9903649 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU501224
TTTGAACCTTTGACATTTTATGGATTAACTAGGCCACCAAATCAATCATGCTTGTTCAATGTGGCTGCAGTGTGGAATTGTGGGATAACAACATAAACCACCATGAAATGATTATTTTCCTTTGCAACTGCTATTTGTGCCGCTTACGCTCCAACCAAAATGGCATTTTTGTCTATGTATGCACTTCGCAAAAACCAATGTGTCCTCATAAAAAAGGTGCAAAAAATGTTGATGGGGAAATAATACTGAGCCAGATACTCACTCAAACCGCATGGGAGGGAACCGGGGTGATATAGAACAGCAAACATGACAGATATTCACCTAAAAACACATTTGCGATAAGGTCAAGCGTATTATTTCTGAGAATTATCGGAAAGCCGCAACCCGTTCCGATTTCTTTTTCGTTGATATCAAGCAACAAACGTGTTTGTTTGTGAGAAACAGGCTGCAAAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU501224 True 454 lncRNA 0.40 1 9903196 9903649
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000306_09887420_09890429 YOD1 coding downstream 12767 9887140 ~ 9890429 (-)
CI01000306_09879930_09884435 NA coding downstream 17926 9878694 ~ 9885270 (-)
CI01000306_09825468_09827244 NA coding downstream 75914 9824575 ~ 9827282 (-)
CI01000306_09801952_09806496 BSNB coding downstream 94396 9801947 ~ 9808800 (-)
CI01000306_09753380_09774568 NA coding downstream 128412 9752368 ~ 9774784 (-)
CI01000306_09944940_09958459 ETNK2 coding upstream 40982 9944631 ~ 9959168 (-)
CI01000306_09983479_10008765 SLC41A1 coding upstream 78944 9982593 ~ 10009753 (-)
CI01000306_10025743_10034143 KLHDC8A coding upstream 122044 10025693 ~ 10034143 (-)
CI01000306_10262423_10269446 ELK4 coding upstream 358774 10262423 ~ 10269446 (-)
CI01000306_10274565_10279388 NA coding upstream 370216 10273865 ~ 10279388 (-)
G436667 NA non-coding downstream 6934 9896024 ~ 9896262 (-)
G436666 NA non-coding downstream 7178 9895783 ~ 9896018 (-)
G436665 NA non-coding downstream 7454 9895518 ~ 9895742 (-)
G436664 NA non-coding downstream 7913 9895042 ~ 9895283 (-)
G436639 NA non-coding downstream 9988 9892180 ~ 9893208 (-)
G436668 NA non-coding upstream 297 9903946 ~ 9904572 (-)
G436674 NA non-coding upstream 60415 9964064 ~ 9964559 (-)
G436680 NA non-coding upstream 109786 10013435 ~ 10013659 (-)
G436642 NA non-coding upstream 174334 10077983 ~ 10109617 (-)
G436716 NA non-coding upstream 231387 10135036 ~ 10135369 (-)
G436626 NA other downstream 66873 9835025 ~ 9836323 (-)
G436446 NA other downstream 231420 9656279 ~ 9671776 (-)
G434338 NA other downstream 3036260 6866656 ~ 6866936 (-)
G434086 NA other downstream 3450945 6437406 ~ 6452251 (-)
G434016 NA other downstream 3541553 6355180 ~ 6361643 (-)
G436643 NA other upstream 118499 10022148 ~ 10025375 (-)

Expression


G436669 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

G436669 Expression in each Bioproject

Bar chart with 19 bars.
G436669 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network