G436668



Basic Information


Item Value
gene id G436668
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9903946 ~ 9904572 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU501223
GTCTTACGGGTTTGGAATGACATGTAATTGATGACAGAATTTTCATTTTTGGGTGAACTAACCCTTTAAAAGTGAAGTTTCCCATACAGACTGGGATGCTCAAACAAACACAGCAATGTTTCAGCATTTATGCTTTTTGAAGGAATCAACCTATGAATGGTTTACTTGTGTGCTTGCACAGAGTATGTTTCTGGCCGTTGTTGGAACGTACCCTATGAGCTCCCAATGTCAGGACAGGCCTTTTGTGCATCAAAAGACTGGTGAACCCAAACACTCTACATCTTGCAAGCATTTCTGCAGAACCGTGGCATTTACAAATGCAAATGACTCCATAGAATGAAGACGTTAATTCAGTCTTTTGGAACACAACCAAACGTTCTTTAGACCCCTTGTCTTCATTATAACACAGCCTGCCTGTCAGGCCTGCAAGAATCACTCTGTATTCTCCGCGCTACACACTATGCCAATTAGGCAATCATTGTGACTAATAAGAATAATCTCACATTGTGGTTGCAAAAATGTCTCACATTATAAAAAGAACTTTGGGAGCGGATATGCCTGTTTTCTGCCTTCCTGTTTGCTTGTGCTTTGCTGTGCTGTTTTACCCCCCAACTCGCCTATTAAAGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU501223 True 627 lncRNA 0.41 1 9903946 9904572
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000306_09887420_09890429 YOD1 coding downstream 13517 9887140 ~ 9890429 (-)
CI01000306_09879930_09884435 NA coding downstream 18676 9878694 ~ 9885270 (-)
CI01000306_09825468_09827244 NA coding downstream 76664 9824575 ~ 9827282 (-)
CI01000306_09801952_09806496 BSNB coding downstream 95146 9801947 ~ 9808800 (-)
CI01000306_09753380_09774568 NA coding downstream 129162 9752368 ~ 9774784 (-)
CI01000306_09944940_09958459 ETNK2 coding upstream 40059 9944631 ~ 9959168 (-)
CI01000306_09983479_10008765 SLC41A1 coding upstream 78021 9982593 ~ 10009753 (-)
CI01000306_10025743_10034143 KLHDC8A coding upstream 121121 10025693 ~ 10034143 (-)
CI01000306_10262423_10269446 ELK4 coding upstream 357851 10262423 ~ 10269446 (-)
CI01000306_10274565_10279388 NA coding upstream 369293 10273865 ~ 10279388 (-)
G436669 NA non-coding downstream 297 9903196 ~ 9903649 (-)
G436667 NA non-coding downstream 7684 9896024 ~ 9896262 (-)
G436666 NA non-coding downstream 7928 9895783 ~ 9896018 (-)
G436665 NA non-coding downstream 8204 9895518 ~ 9895742 (-)
G436664 NA non-coding downstream 8663 9895042 ~ 9895283 (-)
G436674 NA non-coding upstream 59492 9964064 ~ 9964559 (-)
G436680 NA non-coding upstream 108863 10013435 ~ 10013659 (-)
G436642 NA non-coding upstream 173411 10077983 ~ 10109617 (-)
G436716 NA non-coding upstream 230464 10135036 ~ 10135369 (-)
G436648 NA non-coding upstream 349092 10253664 ~ 10322166 (-)
G436626 NA other downstream 67623 9835025 ~ 9836323 (-)
G436446 NA other downstream 232170 9656279 ~ 9671776 (-)
G434338 NA other downstream 3037010 6866656 ~ 6866936 (-)
G434086 NA other downstream 3451695 6437406 ~ 6452251 (-)
G434016 NA other downstream 3542303 6355180 ~ 6361643 (-)
G436643 NA other upstream 117576 10022148 ~ 10025375 (-)

Expression


G436668 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

G436668 Expression in each Bioproject

Bar chart with 28 bars.
G436668 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 15.
End of interactive chart.

Co-expression Network