G435702


Basic Information

Item Value
gene id G435702
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 10053714 ~ 10130880 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU500143
AAACTGAAGAATCTGCAGGACCTGGAGATTTTTTCTGAAGAACAGAGCTCAGTTTAACTGCTCAGGACAAACAAGAGACTCATGAACAACCATCACAAAACAAAAAAAACAGTCATAGATCATCCAGGTAACCACACACAGTGTTAAGAATTAGTGGTTCACATACTTATGAATGGGGTTATTTTAATAAATTCAGCTATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU500143 True 202 lncRNA 0.36 2 10053714 10130880

Neighbor

gene id symbol gene type direction distance location
CI01000306_09971328_09977478 NA coding upstream 75962 9971328 ~ 9977752 (+)
CI01000306_09922070_09935786 SOX13 coding upstream 117307 9922070 ~ 9936407 (+)
CI01000306_09891658_09893015 SNRPE coding upstream 160558 9891532 ~ 9893239 (+)
CI01000306_09866302_09875270 KIF17 coding upstream 177997 9866302 ~ 9875717 (+)
CI01000306_09860935_09865155 SH2D5 coding upstream 188460 9860480 ~ 9865724 (+)
CI01000306_10190981_10191175 NA coding downstream 60101 10190981 ~ 10191195 (+)
CI01000306_10194611_10226157 CDK18 coding downstream 63358 10194238 ~ 10226166 (+)
CI01000306_10241081_10252745 MFSD4A coding downstream 110201 10241081 ~ 10252864 (+)
CI01000306_10304503_10316470 NA coding downstream 173365 10304245 ~ 10316678 (+)
CI01000306_10332743_10335743 NA coding downstream 201781 10332661 ~ 10335849 (+)
G435701 NA non-coding upstream 510 10052877 ~ 10053204 (+)
G435681 NA non-coding upstream 28327 10022328 ~ 10025387 (+)
G435678 NA non-coding upstream 39938 10013535 ~ 10013776 (+)
G435664 NA non-coding upstream 148601 9904858 ~ 9905113 (+)
G435663 NA non-coding upstream 149127 9903949 ~ 9904587 (+)
G435750 NA non-coding downstream 4103 10134983 ~ 10135303 (+)
G435753 NA non-coding downstream 8039 10138919 ~ 10139178 (+)
G435764 NA non-coding downstream 126041 10256921 ~ 10261092 (+)
G435767 NA non-coding downstream 152758 10283638 ~ 10286492 (+)
G435878 NA non-coding downstream 381870 10512750 ~ 10527209 (+)
G435639 NA other upstream 168795 9878664 ~ 9884919 (+)
G435590 NA other upstream 316570 9704707 ~ 9737144 (+)
CI01000306_09263755_09288503 NA other upstream 768385 9263589 ~ 9289035 (+)
G436932 NA other downstream 952108 11082988 ~ 11098376 (+)
G437030 NA other downstream 1138878 11269758 ~ 11271160 (+)

Expression


Co-expression Network