G436716



Basic Information


Item Value
gene id G436716
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 10135036 ~ 10135369 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU501272
CGCTGGACTGCTTCACAAACGAGGGTCAATTCAACGCTGGATTTGCACAAAAGATTAACATGACTCCACATGCTAGTCCATGAGTTGAATCAACTCCACAGCAACTACATAAATTTATCCACTAACCATTCAGAAACGTCCAGTTGTATTCTAAAAGTTGTAACTTCTTCCTGAGTCTCTCCATCAGTGTCCGACTCCGGTTTGAACAATGTAAGGCTGAACACTGTTACTGACAATCCTCATTTTGGCTGCGTGAGATTCTCCAGCTTTGTTGTTGTTGAGCAACCGAAGCGCGAGCTGTTAAAGCTCCACCCTCTTCTGGAAAGCATCCGGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU501272 True 334 lncRNA 0.45 1 10135036 10135369
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000306_10025743_10034143 KLHDC8A coding downstream 100893 10025693 ~ 10034143 (-)
CI01000306_09983479_10008765 SLC41A1 coding downstream 125283 9982593 ~ 10009753 (-)
CI01000306_09944940_09958459 ETNK2 coding downstream 175868 9944631 ~ 9959168 (-)
CI01000306_09887420_09890429 YOD1 coding downstream 244607 9887140 ~ 9890429 (-)
CI01000306_09879930_09884435 NA coding downstream 249766 9878694 ~ 9885270 (-)
CI01000306_10262423_10269446 ELK4 coding upstream 127054 10262423 ~ 10269446 (-)
CI01000306_10274565_10279388 NA coding upstream 138496 10273865 ~ 10279388 (-)
CI01000306_10284481_10290022 SLC45A3 coding upstream 148256 10283625 ~ 10290285 (-)
CI01000306_10298942_10304445 NA coding upstream 163212 10298581 ~ 10304445 (-)
CI01000306_10359441_10361943 NA coding upstream 223367 10358736 ~ 10362160 (-)
G436642 NA non-coding downstream 25419 10077983 ~ 10109617 (-)
G436680 NA non-coding downstream 121377 10013435 ~ 10013659 (-)
G436674 NA non-coding downstream 170477 9964064 ~ 9964559 (-)
G436668 NA non-coding downstream 230464 9903946 ~ 9904572 (-)
G436669 NA non-coding downstream 231387 9903196 ~ 9903649 (-)
G436648 NA non-coding upstream 118295 10253664 ~ 10322166 (-)
G436830 NA non-coding upstream 314748 10450117 ~ 10477553 (-)
G436833 NA non-coding upstream 325751 10461120 ~ 10463301 (-)
G436849 NA non-coding upstream 345073 10480442 ~ 10480671 (-)
G436850 NA non-coding upstream 346390 10481759 ~ 10482192 (-)
G436643 NA other downstream 109661 10022148 ~ 10025375 (-)
G436626 NA other downstream 298713 9835025 ~ 9836323 (-)
G436446 NA other downstream 463260 9656279 ~ 9671776 (-)
G434338 NA other downstream 3268100 6866656 ~ 6866936 (-)
G434086 NA other downstream 3682785 6437406 ~ 6452251 (-)

Expression


G436716 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G436716 Expression in each Bioproject

Bar chart with 34 bars.
G436716 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network