G439278


Basic Information

Item Value
gene id G439278
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 756350 ~ 756572 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU504204
ATTTTGTAGAAACCATGGAAACACCAAAGACGCTTTAATATATTACACTTTTTAATAGACAAGGGAACAACTGTTTTGATATATTTATAGACAGAAAACTAATTGTTGTTATATAGCTCAACACGTTTAGTCTTATTGTTTAAATCTAATTTTCTTGATTTTTTTGCGAGTACCATGCTTTACCATGCCTCAGAGAAAAACACTATTTTGTGAAGTAGCTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU504204 True 223 lncRNA 0.30 1 756350 756572

Neighbor

gene id symbol gene type direction distance location
CI01000310_00637385_00645599 MCM8 coding downstream 110751 636985 ~ 645599 (-)
CI01000310_00631552_00635392 CRLS1 coding downstream 120958 631284 ~ 635392 (-)
CI01000310_00597640_00601450 GDF3 coding downstream 154775 597505 ~ 601575 (-)
CI01000310_00593564_00595487 BMP2, BMP2A coding downstream 160413 593526 ~ 595937 (-)
CI01000310_00415541_00454442 PLCB1 coding downstream 301908 415281 ~ 454442 (-)
CI01000310_00762106_00777075 KCNK10B, KCNK10 coding upstream 5267 761839 ~ 777075 (-)
CI01000310_01278443_01278823 NA coding upstream 521377 1277949 ~ 1279008 (-)
CI01000310_01288093_01294540 NA coding upstream 531478 1288050 ~ 1294540 (-)
CI01000310_01301239_01302430 NA coding upstream 543990 1300562 ~ 1302604 (-)
CI01000310_01381159_01387513 NA coding upstream 624309 1380881 ~ 1388410 (-)
G439267 NA non-coding downstream 24285 730362 ~ 732065 (-)
G439258 NA non-coding downstream 56429 699593 ~ 699921 (-)
G439250 NA non-coding downstream 106489 648565 ~ 649861 (-)
G439248 NA non-coding downstream 108187 647364 ~ 648163 (-)
G439244 NA non-coding downstream 133743 622406 ~ 622607 (-)
G439279 NA non-coding upstream 385 756957 ~ 757182 (-)
G439281 NA non-coding upstream 1429 758001 ~ 758217 (-)
G439283 NA non-coding upstream 2530 759102 ~ 759348 (-)
G439328 NA non-coding upstream 38654 795226 ~ 878041 (-)
G439359 NA non-coding upstream 191170 947742 ~ 990127 (-)
G439012 NA other downstream 422296 332255 ~ 334054 (-)
G439398 NA other upstream 182563 939135 ~ 941564 (-)
G439473 NA other upstream 357788 1114360 ~ 1114833 (-)
G441306 NA other upstream 2070212 2826784 ~ 2827204 (-)
CI01000310_03135568_03137756 NA other upstream 2378060 3134632 ~ 3137756 (-)
CI01000310_03715435_03742324 NA other upstream 2981520 3715028 ~ 3742531 (-)

Expression


Co-expression Network