G439279


Basic Information

Item Value
gene id G439279
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 756957 ~ 757182 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU504205
GTCGTGTCCAGCATCCAGTGTTGACAATATCAGTGATTATAATGGGTTCTATATTGCCTTTTGTCGCGTCGCGCCACTCGCGTCCAGTGTAAACACGGTGTTAGTTACAGATCAAAATAGCGTTACAAAACCTAGATACATTTTTTTTCTTGGGCTTCATGCCAGGGGGTGCTGGCACAGATGTGTGTTTTGCTTGACTTAAAAAGAAGTCTAAAAAGTACTGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU504205 True 226 lncRNA 0.42 1 756957 757182

Neighbor

gene id symbol gene type direction distance location
CI01000310_00637385_00645599 MCM8 coding downstream 111358 636985 ~ 645599 (-)
CI01000310_00631552_00635392 CRLS1 coding downstream 121565 631284 ~ 635392 (-)
CI01000310_00597640_00601450 GDF3 coding downstream 155382 597505 ~ 601575 (-)
CI01000310_00593564_00595487 BMP2, BMP2A coding downstream 161020 593526 ~ 595937 (-)
CI01000310_00415541_00454442 PLCB1 coding downstream 302515 415281 ~ 454442 (-)
CI01000310_00762106_00777075 KCNK10B, KCNK10 coding upstream 4657 761839 ~ 777075 (-)
CI01000310_01278443_01278823 NA coding upstream 520767 1277949 ~ 1279008 (-)
CI01000310_01288093_01294540 NA coding upstream 530868 1288050 ~ 1294540 (-)
CI01000310_01301239_01302430 NA coding upstream 543380 1300562 ~ 1302604 (-)
CI01000310_01381159_01387513 NA coding upstream 623699 1380881 ~ 1388410 (-)
G439278 NA non-coding downstream 385 756350 ~ 756572 (-)
G439267 NA non-coding downstream 24892 730362 ~ 732065 (-)
G439258 NA non-coding downstream 57036 699593 ~ 699921 (-)
G439250 NA non-coding downstream 107096 648565 ~ 649861 (-)
G439248 NA non-coding downstream 108794 647364 ~ 648163 (-)
G439281 NA non-coding upstream 819 758001 ~ 758217 (-)
G439283 NA non-coding upstream 1920 759102 ~ 759348 (-)
G439328 NA non-coding upstream 38044 795226 ~ 878041 (-)
G439359 NA non-coding upstream 190560 947742 ~ 990127 (-)
G439416 NA non-coding upstream 223152 980334 ~ 1023679 (-)
G439012 NA other downstream 422903 332255 ~ 334054 (-)
G439398 NA other upstream 181953 939135 ~ 941564 (-)
G439473 NA other upstream 357178 1114360 ~ 1114833 (-)
G441306 NA other upstream 2069602 2826784 ~ 2827204 (-)
CI01000310_03135568_03137756 NA other upstream 2377450 3134632 ~ 3137756 (-)
CI01000310_03715435_03742324 NA other upstream 2980910 3715028 ~ 3742531 (-)

Expression


Co-expression Network