G439444


Basic Information

Item Value
gene id G439444
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 1055855 ~ 1056384 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU504426
AAGGAACCCCCAAGCTTGTGCCAGGCTTCGGCCTAGACCTTCCATTCACCATGGTCCTCTGAATCCAACTGGTTCTCTTTCATCAAGACAATATCAGCAAAGATTCAACGGGAGCCTCCACAAATCGCATCAGGACAGTTTTAATTTAACTTGGAGAGACATGCAAGTATCAAACTTAGTCTCATTATCTGATACATTGAATATCCTTACCCCTTTTAAAGAAGGGCCTGTTAAAACTAAACTGATGGTTTGCTCAAGGCTGTTGATCTGCTGAATTTCAAACAATGCTGTAACTTCTTGCTTTCCTATACTCTGCTTCAACTCTCTCTTTCCCTTGGTAAACTGTATGCATGTATGTGTGTGAATGTTAGAGTAATTAAGTGTTTAGTCTAGTTAATAAAGTCTTGTTCATGTCACACGTAAAGTTGTCCGTGTTTCACGCTCATATACTGGAGTCCCTATTCATGCAGATCCTGACTACAGGCTCTGAGTAGTACTGTACAATAAGATTGTTATTTCCCATAACCTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU504426 True 530 lncRNA 0.40 1 1055855 1056384

Neighbor

gene id symbol gene type direction distance location
CI01000310_00762106_00777075 KCNK10B, KCNK10 coding downstream 278780 761839 ~ 777075 (-)
CI01000310_00637385_00645599 MCM8 coding downstream 410256 636985 ~ 645599 (-)
CI01000310_00631552_00635392 CRLS1 coding downstream 420463 631284 ~ 635392 (-)
CI01000310_00597640_00601450 GDF3 coding downstream 454280 597505 ~ 601575 (-)
CI01000310_00593564_00595487 BMP2, BMP2A coding downstream 459918 593526 ~ 595937 (-)
CI01000310_01278443_01278823 NA coding upstream 221565 1277949 ~ 1279008 (-)
CI01000310_01288093_01294540 NA coding upstream 231666 1288050 ~ 1294540 (-)
CI01000310_01301239_01302430 NA coding upstream 244178 1300562 ~ 1302604 (-)
CI01000310_01381159_01387513 NA coding upstream 324497 1380881 ~ 1388410 (-)
CI01000310_01481888_01490264 CLIC4, CLIC5, CLIC5A, CLIC5B coding upstream 425012 1481396 ~ 1490555 (-)
G439443 NA non-coding downstream 228 1055407 ~ 1055627 (-)
G439442 NA non-coding downstream 1074 1054446 ~ 1054781 (-)
G439416 NA non-coding downstream 32176 980334 ~ 1023679 (-)
G439359 NA non-coding downstream 65728 947742 ~ 990127 (-)
G439328 NA non-coding downstream 177814 795226 ~ 878041 (-)
G439445 NA non-coding upstream 1572 1057956 ~ 1058278 (-)
G439448 NA non-coding upstream 5834 1062218 ~ 1062689 (-)
G439449 NA non-coding upstream 7714 1064098 ~ 1064309 (-)
G439452 NA non-coding upstream 18492 1074876 ~ 1075202 (-)
G439459 NA non-coding upstream 39783 1096167 ~ 1096492 (-)
G439398 NA other downstream 114291 939135 ~ 941564 (-)
G439012 NA other downstream 721801 332255 ~ 334054 (-)
G439473 NA other upstream 57976 1114360 ~ 1114833 (-)
G441306 NA other upstream 1770400 2826784 ~ 2827204 (-)
CI01000310_03135568_03137756 NA other upstream 2078248 3134632 ~ 3137756 (-)
CI01000310_03715435_03742324 NA other upstream 2681708 3715028 ~ 3742531 (-)
G441605 NA other upstream 2729511 3785895 ~ 3791370 (-)

Expression


Co-expression Network