G439452



Basic Information


Item Value
gene id G439452
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 1074876 ~ 1075202 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU504437
GTTTGCCACCTGATGTCACCTGTTGGAGTTTGGGTTCCTTGCCGCTGTCGCCTTTGGCTTGCTTAGTTGGGGACACTTGATATTTGACATTTGATATTCAACAGTGCTTTGCATCTGCCTGCATTGACACCATTTTCTTTAAGAGCTGCTGTGCAGCCAAAATTATATACCAGTTATCACTGTAAAGCTGCTTTGACACAATCTGCATTGTAAAAAACGCTATATAAAAACGCTATATAAATAAAGGTGACTTGACTTGACTTGTATTGAGGTAAACATCCAAGGAGGCTCAAAGAGAGCCTAACTACCTAGCACACTACCCTCCCG

Function


NR:

description
regulator of G-protein signaling 5-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU504437 True 327 lncRNA 0.42 1 1074876 1075202

Neighbor


gene id symbol gene type direction distance location
CI01000310_00762106_00777075 KCNK10B, KCNK10 coding downstream 297801 761839 ~ 777075 (-)
CI01000310_00637385_00645599 MCM8 coding downstream 429277 636985 ~ 645599 (-)
CI01000310_00631552_00635392 CRLS1 coding downstream 439484 631284 ~ 635392 (-)
CI01000310_00597640_00601450 GDF3 coding downstream 473301 597505 ~ 601575 (-)
CI01000310_00593564_00595487 BMP2, BMP2A coding downstream 478939 593526 ~ 595937 (-)
CI01000310_01278443_01278823 NA coding upstream 202747 1277949 ~ 1279008 (-)
CI01000310_01288093_01294540 NA coding upstream 212848 1288050 ~ 1294540 (-)
CI01000310_01301239_01302430 NA coding upstream 225360 1300562 ~ 1302604 (-)
CI01000310_01381159_01387513 NA coding upstream 305679 1380881 ~ 1388410 (-)
CI01000310_01481888_01490264 CLIC4, CLIC5, CLIC5A, CLIC5B coding upstream 406194 1481396 ~ 1490555 (-)
G439449 NA non-coding downstream 10567 1064098 ~ 1064309 (-)
G439448 NA non-coding downstream 12187 1062218 ~ 1062689 (-)
G439445 NA non-coding downstream 16598 1057956 ~ 1058278 (-)
G439444 NA non-coding downstream 18492 1055855 ~ 1056384 (-)
G439443 NA non-coding downstream 19249 1055407 ~ 1055627 (-)
G439459 NA non-coding upstream 20965 1096167 ~ 1096492 (-)
G439467 NA non-coding upstream 23966 1099168 ~ 1099495 (-)
G439469 NA non-coding upstream 29811 1105013 ~ 1105261 (-)
G439472 NA non-coding upstream 35874 1111076 ~ 1111359 (-)
G439473 NA non-coding upstream 39336 1114360 ~ 1114833 (-)
G439398 NA other downstream 133312 939135 ~ 941564 (-)
G439012 NA other downstream 740822 332255 ~ 334054 (-)
G441306 NA other upstream 1751582 2826784 ~ 2827204 (-)
CI01000310_03135568_03137756 NA other upstream 2059430 3134632 ~ 3137756 (-)
CI01000310_03715435_03742324 NA other upstream 2662890 3715028 ~ 3742531 (-)
G441605 NA other upstream 2710693 3785895 ~ 3791370 (-)

Expression



Co-expression Network