G440026


Basic Information

Item Value
gene id G440026
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 1421321 ~ 1421615 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU505106
CTCAAGAAACCTGTTGCTGGTGGTTTTGGAGTTTGTTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTGTACAGGATGGTGAGATCTGTTTGTTTAGTTATATTAGAATAGAGGGAAAGCATAGGTAAGTAAGCTGACCCGGAAGATTCTTTTGTGTTTGTTATTTTTCTCGGGAGTGAGGAAAGTTTAACTCTGAGTTGTAGTTTAGATTAGTTAGCTCACCAGTCCTGATGTGAGTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU505106 True 275 lncRNA 0.34 2 1421321 1421615

Neighbor

gene id symbol gene type direction distance location
CI01000310_01381159_01387513 NA coding downstream 32911 1380881 ~ 1388410 (-)
CI01000310_01301239_01302430 NA coding downstream 118717 1300562 ~ 1302604 (-)
CI01000310_01288093_01294540 NA coding downstream 126781 1288050 ~ 1294540 (-)
CI01000310_01278443_01278823 NA coding downstream 142313 1277949 ~ 1279008 (-)
CI01000310_00762106_00777075 KCNK10B, KCNK10 coding downstream 644246 761839 ~ 777075 (-)
CI01000310_01481888_01490264 CLIC4, CLIC5, CLIC5A, CLIC5B coding upstream 59781 1481396 ~ 1490555 (-)
CI01000310_01494640_01499198 ENPP4 coding upstream 71618 1492557 ~ 1500181 (-)
CI01000310_01533834_01553414 XKR6A, XKR6 coding upstream 111353 1532968 ~ 1553665 (-)
CI01000310_01572894_01581072 NA coding upstream 151228 1572843 ~ 1581142 (-)
CI01000310_01606611_01612756 BLK coding upstream 184761 1606376 ~ 1612756 (-)
G440079 NA non-coding downstream 194109 1226240 ~ 1227212 (-)
G440068 NA non-coding downstream 216917 1204165 ~ 1204404 (-)
G440056 NA non-coding downstream 256748 1164280 ~ 1164573 (-)
G440054 NA non-coding downstream 258160 1162887 ~ 1163161 (-)
G440051 NA non-coding downstream 260691 1160388 ~ 1160630 (-)
G440120 NA non-coding upstream 43431 1465046 ~ 1465301 (-)
G440122 NA non-coding upstream 44915 1466530 ~ 1466802 (-)
G440123 NA non-coding upstream 45301 1466916 ~ 1467132 (-)
G440126 NA non-coding upstream 49792 1471407 ~ 1471720 (-)
G439473 NA other downstream 306488 1114360 ~ 1114833 (-)
G439398 NA other downstream 479757 939135 ~ 941564 (-)
G439012 NA other downstream 1087267 332255 ~ 334054 (-)
G441306 NA other upstream 1405169 2826784 ~ 2827204 (-)
CI01000310_03135568_03137756 NA other upstream 1713017 3134632 ~ 3137756 (-)
CI01000310_03715435_03742324 NA other upstream 2316477 3715028 ~ 3742531 (-)
G441605 NA other upstream 2364280 3785895 ~ 3791370 (-)
G441618 NA other upstream 2513764 3968183 ~ 4028466 (-)

Expression


Co-expression Network