G439788


Basic Information

Item Value
gene id G439788
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 1855802 ~ 1856200 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU504832
GGAACTTCCAATGCGAAGGATGGATTGACACATGAAAGTAAGCGTCTTTCAGATCTATTGTCACAAACCAGTCCTCGGACCTGATCTGTGTAGTGATCTGTTTGAGTGTAAGCATCTTGAACTTGAGCTTTTGCACTGAACGATTTAACATGCGCAAATCTAGAATAGGACGCAACCCTCCATCCTTCTTCGGAACGATGAAGTAGCGGCTGTAAAACCCTGACTGCTTGCTGGGAGGAGGAACCCTTTCTATAGCTCCTTTTCGCAAGAGTGTCATAACTTCTTGTTCCATAACCAGAGACTGCTCGGGACCCACCACTGTAGGAAGGACCCCTTTGAACTGGGGCGGGCGAAATCCGAACTGTATTTTGTAACCCATTTCTATTGTAAGCAGCACCC

Function

NR:

description
regulator of G-protein signaling 4-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU504832 True 399 lncRNA 0.47 1 1855802 1856200

Neighbor

gene id symbol gene type direction distance location
CI01000310_01814975_01815586 DUS23, DUSP23B, DUSP23, TP53I3 coding upstream 40146 1814975 ~ 1815656 (+)
CI01000310_01737635_01745606 CHRNA2A, CHRNA2 coding upstream 110115 1737635 ~ 1745687 (+)
CI01000310_01723036_01723254 NA coding upstream 132252 1723036 ~ 1723550 (+)
CI01000310_01693209_01696414 NA coding upstream 158931 1692729 ~ 1696871 (+)
CI01000310_01674884_01675180 NA coding upstream 180537 1674244 ~ 1675265 (+)
CI01000310_01887698_01893727 CX23, GJE1 coding downstream 31100 1887300 ~ 1893840 (+)
CI01000310_01941915_01945313 TATDN3 coding downstream 85715 1941915 ~ 1945642 (+)
CI01000310_01947567_01956704 ADCK3 coding downstream 91367 1947567 ~ 1956760 (+)
CI01000310_01981356_01982015 NA coding downstream 124775 1980975 ~ 1982224 (+)
CI01000310_01992187_02003475 SLC5A6B coding downstream 135440 1991640 ~ 2003475 (+)
G439760 NA non-coding upstream 33537 1820365 ~ 1822265 (+)
G439764 NA non-coding upstream 36543 1818893 ~ 1819259 (+)
G439776 NA non-coding upstream 76970 1774347 ~ 1778832 (+)
G439759 NA non-coding upstream 85242 1761392 ~ 1770560 (+)
G439697 NA non-coding upstream 182336 1670882 ~ 1673466 (+)
G439790 NA non-coding downstream 5638 1861838 ~ 1862314 (+)
G439842 NA non-coding downstream 38508 1894708 ~ 1896961 (+)
G439841 NA non-coding downstream 41360 1897560 ~ 1898250 (+)
G439843 NA non-coding downstream 43166 1899366 ~ 1903564 (+)
G439844 NA non-coding downstream 48569 1904769 ~ 1905180 (+)
CI01000310_01508712_01511125 FAM167A other upstream 342461 1508341 ~ 1513341 (+)
CI01000310_01207513_01226750 CDC5L other upstream 616397 1207057 ~ 1227194 (+)
G439115 NA other upstream 1164610 651976 ~ 653356 (+)
CI01000310_00648731_00650082 NAPB other upstream 1206249 648566 ~ 650159 (+)
G439845 NA other downstream 55401 1911601 ~ 1912417 (+)
G440505 NA other downstream 1243217 3099417 ~ 3136328 (+)

Expression


Co-expression Network