G440419


Basic Information

Item Value
gene id G440419
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 2632896 ~ 2633199 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU505613
CCCTCAAGCCATCCTAGGTGTTTATGACTATCTTCTTTCAGACGAACACAATCGGAGTTATATCAAAAAATATCCTGGCTCTTCCAAACTTGATAAAGATAGTGAAGGGGGCGTGAGATTTTGAAGCCCAAAAAAGCGCATCAATCCATCATAAATGTAATGTATGCGGATAGAGTGGGTTAATAAATGCCTTCTGAATTGAAGCTATGCAGTTTTTTGTAAGAAAAATATCCATATTTAAAACTTTATTAACTATAACATCTATCTTCCGGCAGACGGCCGTACGCATCTATTTACAGCAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU505613 True 304 lncRNA 0.37 1 2632896 2633199

Neighbor

gene id symbol gene type direction distance location
CI01000310_02572928_02575251 FBXO30A, FBXO30 coding upstream 57540 2572928 ~ 2575356 (+)
CI01000310_02562834_02569144 NA coding upstream 63639 2562389 ~ 2569257 (+)
CI01000310_02549824_02559417 SHPRH coding upstream 73405 2549824 ~ 2559491 (+)
CI01000310_02482727_02513419 KCNK5, KCNK5A coding upstream 119117 2482069 ~ 2513779 (+)
CI01000310_02164574_02165132 DDO coding upstream 467598 2164574 ~ 2165298 (+)
CI01000310_02639022_02649415 NA coding downstream 5823 2639022 ~ 2649666 (+)
CI01000310_02658724_02665972 CCDC170 coding downstream 25525 2658724 ~ 2666179 (+)
CI01000310_02789811_02790561 MYCT1B, MYCT1 coding downstream 156331 2789530 ~ 2791080 (+)
CI01000310_02793777_02805490 TULP4 coding downstream 160578 2793777 ~ 2807092 (+)
CI01000310_02810800_02814032 SLC18B1 coding downstream 177110 2810309 ~ 2814084 (+)
G440383 NA non-coding upstream 88821 2543873 ~ 2544075 (+)
G440378 NA non-coding upstream 95126 2537412 ~ 2537770 (+)
G440373 NA non-coding upstream 101605 2531087 ~ 2531291 (+)
G440372 NA non-coding upstream 102415 2530218 ~ 2530481 (+)
G440420 NA non-coding downstream 2001 2635200 ~ 2635461 (+)
G440401 NA non-coding downstream 19240 2652439 ~ 2653394 (+)
G440423 NA non-coding downstream 24402 2657601 ~ 2657838 (+)
G440427 NA non-coding downstream 42101 2675300 ~ 2676499 (+)
G440472 NA non-coding downstream 193550 2826749 ~ 2827136 (+)
G439845 NA other upstream 720479 1911601 ~ 1912417 (+)
CI01000310_01508712_01511125 FAM167A other upstream 1119555 1508341 ~ 1513341 (+)
CI01000310_01207513_01226750 CDC5L other upstream 1393491 1207057 ~ 1227194 (+)
G439115 NA other upstream 1941704 651976 ~ 653356 (+)
CI01000310_00648731_00650082 NAPB other upstream 1983343 648566 ~ 650159 (+)
G440505 NA other downstream 466218 3099417 ~ 3136328 (+)

Expression


Co-expression Network