CI01000319_03394244_03396334 (BTR26, BTR18, BTY, BTR25, BTR22)


Basic Information

Item Value
gene id CI01000319_03394244_03396334
gene name BTR26, BTR18, BTY, BTR25, BTR22
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 3394244 ~ 3396614 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000319_03394244_03396334.mRNA
ACTCAACTGATGAAGACACAGAAAGACACACAGCAGATGATCCAGGACAGAATCAAGAAGATTCAAGATGTCAAACACTCAGCAGAAGTCAGAAAAATCACACTGAGTCCCAATGATGGATTCTGGACTGTGATTCTGAGGAATGAGAATGAATATAAAGCCGGTGCTGGTCCCTCTGTCTCTCTGTCTCTGAGAGTGAAGCCGCAGCGGGTCGGTGTGTTTGTGGATTATGAGGAGGGTCTGGTCTCCTTTTATGATGTGGAGTCCAGCTCTCATATCTACTCTTTCACTGGTCAGTCTTTCACTGACAAACTCTATCCATATTTTAGCCCAGAATTTAATGATGGAGGTAAAAACTCAACTCCACTGATCATCACACCTGTCAAATACAATAAATGAATTTACACCCCAATATGAAATACTTGATGAAAATAATGATTTTTATAATTACAATTCTGAAAACATTATCTATGTGCTGCTGTTCAGAGGATGAAGGATGCATTTTTTCATTTGTTTTTAAAATCAATCTGTAATTAATAATCTGTAATTTTAACA

Function

symbol description
bty Predicted to enable ubiquitin-protein transferase activity and zinc ion binding activity. Acts upstream of or within erythrocyte differentiation. Is expressed in several structures, including DEL; deep blastomere; hematopoietic system; tail bud; and yolk syncytial layer.
btr26 Predicted to enable ubiquitin-protein transferase activity and zinc ion binding activity. Predicted to act upstream of or within protein ubiquitination.
btr22 Predicted to enable ubiquitin-protein transferase activity and zinc ion binding activity. Predicted to act upstream of or within protein ubiquitination. Orthologous to human TRIM17 (tripartite motif containing 17); TRIM38 (tripartite motif containing 38); and TRIM7 (tripartite motif containing 7).
btr18 Predicted to enable zinc ion binding activity.
btr25 Predicted to enable zinc ion binding activity. Orthologous to several human genes including TRIM21 (tripartite motif containing 21); TRIM58 (tripartite motif containing 58); and TRIM68 (tripartite motif containing 68).

GO:

id name namespace
GO:0030218 erythrocyte differentiation biological_process

KEGG:

id description
K12015 TRIM39; tripartite motif-containing protein 39

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000319_03394244_03396334.mRNA False 555 mRNA 0.38 2 3394244 3396490

Neighbor

gene id symbol gene type direction distance location
CI01000319_03389749_03391750 NA coding upstream 2253 3389749 ~ 3391991 (+)
CI01000319_03307678_03308097 NA coding upstream 85781 3306484 ~ 3308463 (+)
CI01000319_03295425_03299640 LSM10 coding upstream 93568 3295425 ~ 3300676 (+)
CI01000319_03283470_03293866 OSCP1A coding upstream 100318 3283431 ~ 3293926 (+)
CI01000319_03238023_03240147 NA coding upstream 153961 3238023 ~ 3240283 (+)
CI01000319_03402932_03447997 BTR26, BTR25, BTR24, BTY, BTR22, BTR18 coding downstream 5622 3402112 ~ 3448275 (+)
CI01000319_03483504_03487172 NA coding downstream 84493 3480983 ~ 3488654 (+)
CI01000319_03500024_03502600 NA coding downstream 102782 3499272 ~ 3502830 (+)
CI01000319_03529404_03549529 NA coding downstream 131590 3528080 ~ 3549725 (+)
CI01000319_03582485_03652347 TRAPPC9 coding downstream 185995 3582485 ~ 3652447 (+)
G451741 NA non-coding upstream 17538 3376429 ~ 3376706 (+)
G451666 NA non-coding upstream 18477 3350739 ~ 3375767 (+)
G451663 NA non-coding upstream 65232 3294651 ~ 3329012 (+)
G451667 NA non-coding upstream 82304 3211189 ~ 3311940 (+)
G451690 NA non-coding upstream 187878 3189616 ~ 3206366 (+)
G452051 NA non-coding downstream 67006 3463496 ~ 3464355 (+)
G452053 NA non-coding downstream 109254 3505744 ~ 3506186 (+)
G452045 NA non-coding downstream 140060 3536550 ~ 3539369 (+)
G451662 NA other upstream 59420 3333281 ~ 3334824 (+)
G451677 NA other upstream 164913 3216340 ~ 3229331 (+)
G451500 NA other upstream 555295 2838086 ~ 2838949 (+)
G451485 NA other upstream 649721 2742741 ~ 2744523 (+)
G451367 NA other upstream 911823 2481064 ~ 2482421 (+)
G452043 NA other downstream 102836 3500279 ~ 3500512 (+)
CI01000319_04515268_04534770 NA other downstream 1135129 4515268 ~ 4536025 (+)
CI01000319_04787066_04788609 EIF1B, EIF1, GM6900 other downstream 1390550 4787040 ~ 4790529 (+)
G452541 NA other downstream 1943032 5336085 ~ 5353023 (+)
G451683 NA non-coding upstream 183884 3180896 ~ 3212205 (+)

Expression


Co-expression Network