CI01000319_04581466_04584558 (ENO2, ENOG)


Basic Information

Item Value
gene id CI01000319_04581466_04584558
gene name ENO2, ENOG
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 4581466 ~ 4584565 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000319_04581466_04584558.mRNA
ATGAAGACATATTATTTGAGTGTGAAGACAAAAATAACAGTGGTGTCCATTGAGGACCCGTTTGATCAGGATGACTGGGCCGCTTGGACTAACATGACGGGGTCAGTGGGGATCCAGATTGTGGGCGACGACCTGACCGTGACAAACCCAAAGAGGATAGAGAAGGCTGCGGAAGACCGCGCATGCAACTGTCTGCTCCTGAAGGTCAACCAGATCGGCACGGTCACAGAGGCCATCCAGGCATGTAAGCTCGCTCAGGCCAACGGATGGGGCGTGATGGTCAGCCATCGCTCAGGAGAGACAGAAGACACTTTCATCGCTGATCTAGTGGTGGGACTCTGCACTGGACAGATAAAGACAGGAGCTCCATGCAGATCTGAGCGTCTCGCCAAATACAACCAACTTATGAGGCAAGAGAGCATTCAAGCACACTATTTTTAGCAGCTCA

Function

symbol description
eno2 Predicted to enable phosphopyruvate hydratase activity. Predicted to be involved in glycolytic process and regulation of vacuole fusion, non-autophagic. Predicted to be part of phosphopyruvate hydratase complex. Is expressed in musculature system; nervous system; neural tube; presumptive neural retina; and trigeminal placode. Human ortholog(s) of this gene implicated in prostate cancer. Orthologous to human ENO2 (enolase 2).

GO:

id name namespace
GO:0000287 magnesium ion binding molecular_function

KEGG:

id description
K01689 ENO, eno; enolase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000319_04581466_04584558.mRNA True 448 mRNA 0.52 4 4581466 4584565

Neighbor

gene id symbol gene type direction distance location
CI01000319_04550077_04553516 MREG coding upstream 26358 4548969 ~ 4555108 (+)
CI01000319_04536287_04545417 STARD3 coding upstream 34598 4536287 ~ 4546868 (+)
CI01000319_04515268_04534770 NA coding upstream 46564 4515268 ~ 4536025 (+)
CI01000319_04478393_04509691 CDK12, CDK13 coding upstream 71129 4478393 ~ 4510337 (+)
CI01000319_04424107_04437627 NA coding upstream 143619 4423822 ~ 4437847 (+)
CI01000319_04626091_04632375 ZNF646 coding downstream 41195 4625760 ~ 4632569 (+)
CI01000319_04697405_04706265 NA coding downstream 110598 4695163 ~ 4706544 (+)
CI01000319_04714806_04715176 NA coding downstream 130241 4714806 ~ 4715569 (+)
CI01000319_04716980_04720666 NA coding downstream 131876 4716441 ~ 4720672 (+)
CI01000319_04741909_04748409 NA coding downstream 156415 4740980 ~ 4748943 (+)
G452257 NA non-coding upstream 19778 4561039 ~ 4561688 (+)
G452309 NA non-coding upstream 32645 4548607 ~ 4548821 (+)
G452277 NA non-coding upstream 63433 4516692 ~ 4518033 (+)
G452306 NA non-coding upstream 104133 4477095 ~ 4477333 (+)
G452274 NA non-coding downstream 11104 4595669 ~ 4601541 (+)
G452261 NA non-coding downstream 80555 4665120 ~ 4761324 (+)
G452351 NA non-coding downstream 193345 4777910 ~ 4778144 (+)
G452390 NA non-coding downstream 360388 4944953 ~ 4945452 (+)
G452427 NA non-coding downstream 474417 5058982 ~ 5059335 (+)
G452043 NA other upstream 1036747 3500279 ~ 3500512 (+)
CI01000319_03402932_03447997 BTR26, BTR25, BTR24, BTY, BTR22, BTR18 other upstream 1160866 3402112 ~ 3448275 (+)
G451662 NA other upstream 1246642 3333281 ~ 3334824 (+)
G451677 NA other upstream 1352135 3216340 ~ 3229331 (+)
CI01000319_04787066_04788609 EIF1B, EIF1, GM6900 other downstream 202475 4787040 ~ 4790529 (+)
G452541 NA other downstream 754957 5336085 ~ 5353023 (+)
G452545 NA other downstream 769129 5353694 ~ 5356035 (+)
G452543 NA other downstream 775135 5359700 ~ 5371484 (+)
G452735 NA other downstream 1123597 5712686 ~ 5712732 (+)

Expression


Co-expression Network