G451677


Basic Information

Item Value
gene id G451677
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 3216340 ~ 3229331 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU518612
CTTCTAAAGAAACAGTGTTGTGGTTCTTGTGGTCTGTTACAGCACACATCGGACACACACATGTCTGTTCATCTCTACAGAACAGCTCCAGAGGTCTCTCATGTTTCTGACATATATAGTCCTCCAGATTCCTCACAGGATTGATCAGTTTGTGTTTCTTTAAACCTGCCACTCTCAAATGAGGCTCCAGGTGAGTTTCACAGTAAGAGCTCTGACACACCAGACACGACTTCAGGGCTTTCAGCTTTCTTTCCTCACAGACGTCACACAGAACTTCAGGTTTTTTCAGAACTTCAGGTTTTTTCTCAGGACTTTTCTTTTTATAGTGATCTACGAGCTCTCGGAGTGTGGTATTAATCTTGAGATCAGGTCTGATCTTGAATGTTTCTTTACAATATGGACAGTTGCAGGTCTGGCTGTTGTCCCAGCACTTATTCAGACAGGTCTTGCAGAAGTTGTGTCCACATGGAGTGCTGACTGGATCAGTGAACACATCCAGACATATCGAGCACTGAAGCTC

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU518612 True 520 TUCP 0.44 2 3216340 3229331

Neighbor

gene id symbol gene type direction distance location
CI01000319_03139476_03152542 NEDD9 coding upstream 63770 3139373 ~ 3152570 (+)
CI01000319_03125942_03128108 NA coding upstream 87812 3125866 ~ 3128528 (+)
CI01000319_03067481_03071297 NA coding upstream 144993 3066768 ~ 3071477 (+)
CI01000319_03020934_03021218 NA coding upstream 194777 3020766 ~ 3021563 (+)
CI01000319_03011414_03016792 NA coding upstream 199145 3009565 ~ 3017195 (+)
CI01000319_03238023_03240147 NA coding downstream 8692 3238023 ~ 3240283 (+)
CI01000319_03283470_03293866 OSCP1A coding downstream 54100 3283431 ~ 3293926 (+)
CI01000319_03295425_03299640 LSM10 coding downstream 66094 3295425 ~ 3300676 (+)
CI01000319_03307678_03308097 NA coding downstream 77153 3306484 ~ 3308463 (+)
CI01000319_03389749_03391750 NA coding downstream 160418 3389749 ~ 3391991 (+)
G451683 NA non-coding upstream 4135 3180896 ~ 3212205 (+)
G451690 NA non-coding upstream 9974 3189616 ~ 3206366 (+)
G451655 NA non-coding upstream 53972 3114527 ~ 3162368 (+)
G451653 NA non-coding upstream 136573 3079555 ~ 3079767 (+)
G451652 NA non-coding upstream 137412 3078726 ~ 3078928 (+)
G451663 NA non-coding downstream 65320 3294651 ~ 3329012 (+)
G451666 NA non-coding downstream 121408 3350739 ~ 3375767 (+)
G451741 NA non-coding downstream 147098 3376429 ~ 3376706 (+)
CI01000319_03394244_03396334 BTR26, BTR18, BTY, BTR25, BTR22 non-coding downstream 166758 3394244 ~ 3396614 (+)
CI01000319_03402932_03447997 BTR26, BTR25, BTR24, BTY, BTR22, BTR18 non-coding downstream 174866 3402112 ~ 3448275 (+)
G451500 NA other upstream 377391 2838086 ~ 2838949 (+)
G451485 NA other upstream 471817 2742741 ~ 2744523 (+)
G451357 NA other upstream 725047 2467916 ~ 2491293 (+)
G451367 NA other upstream 733919 2481064 ~ 2482421 (+)
CI01000319_02344195_02381474 NA other upstream 837289 2344195 ~ 2381474 (+)
G451662 NA other downstream 103950 3333281 ~ 3334824 (+)
G452043 NA other downstream 269995 3500279 ~ 3500512 (+)
CI01000319_04515268_04534770 NA other downstream 1302288 4515268 ~ 4536025 (+)
CI01000319_04787066_04788609 EIF1B, EIF1, GM6900 other downstream 1557709 4787040 ~ 4790529 (+)

Expression


Co-expression Network