G452306


Basic Information

Item Value
gene id G452306
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 4477095 ~ 4477333 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU519321
GCTAACTGTAGTAAAAGTAACAAGTAATTGTCTGTGGACAATGTTCATGGTCTTTAAGGTCGAATATAACTATTTTATGATATAATATTACCAGTTTTATAGTTGTCATGTTACCAAACTGGTAAAATATTACATTTTTTCATAAAAAAACAAAACAAAAACAAATACATGAGCTACATTTCAGATGAATTCAATGTATTATTTGTAGTTCTACACAGAAAGTTAGTTGTCATTCTGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU519321 True 239 lncRNA 0.27 1 4477095 4477333

Neighbor

gene id symbol gene type direction distance location
CI01000319_04424107_04437627 NA coding upstream 39248 4423822 ~ 4437847 (+)
CI01000319_04002430_04030246 FAM135B coding upstream 446732 4002430 ~ 4030363 (+)
CI01000319_03873107_03926475 COL22A1 coding upstream 550006 3871586 ~ 3927089 (+)
CI01000319_03839724_03847827 KCNK9 coding upstream 628172 3839682 ~ 3848923 (+)
CI01000319_03786208_03790365 NA coding upstream 686095 3786208 ~ 3791000 (+)
CI01000319_04478393_04509691 CDK12, CDK13 coding downstream 1060 4478393 ~ 4510337 (+)
CI01000319_04515268_04534770 NA coding downstream 37935 4515268 ~ 4536025 (+)
CI01000319_04536287_04545417 STARD3 coding downstream 58954 4536287 ~ 4546868 (+)
CI01000319_04550077_04553516 MREG coding downstream 71636 4548969 ~ 4555108 (+)
CI01000319_04581466_04584558 ENO2, ENOG coding downstream 104133 4581466 ~ 4584565 (+)
G452267 NA non-coding upstream 24630 4449389 ~ 4452465 (+)
G452300 NA non-coding upstream 29062 4447789 ~ 4448033 (+)
G452299 NA non-coding upstream 30370 4446491 ~ 4446725 (+)
G452298 NA non-coding upstream 30898 4445963 ~ 4446197 (+)
G452297 NA non-coding upstream 31780 4444567 ~ 4445315 (+)
G452277 NA non-coding downstream 39359 4516692 ~ 4518033 (+)
G452309 NA non-coding downstream 71274 4548607 ~ 4548821 (+)
G452257 NA non-coding downstream 83706 4561039 ~ 4561688 (+)
G452256 NA non-coding downstream 98039 4575372 ~ 4582676 (+)
G452043 NA other upstream 932376 3500279 ~ 3500512 (+)
CI01000319_03402932_03447997 BTR26, BTR25, BTR24, BTY, BTR22, BTR18 other upstream 1056495 3402112 ~ 3448275 (+)
G451662 NA other upstream 1142271 3333281 ~ 3334824 (+)
G451677 NA other upstream 1247764 3216340 ~ 3229331 (+)
G451500 NA other upstream 1638146 2838086 ~ 2838949 (+)
CI01000319_04787066_04788609 EIF1B, EIF1, GM6900 other downstream 309707 4787040 ~ 4790529 (+)
G452541 NA other downstream 862189 5336085 ~ 5353023 (+)
G452545 NA other downstream 876361 5353694 ~ 5356035 (+)
G452543 NA other downstream 882367 5359700 ~ 5371484 (+)

Expression


Co-expression Network