G452804


Basic Information

Item Value
gene id G452804
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 5582351 ~ 5582561 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU519879
CAGTCTTTGCCGCCATCTAATGGCGTAATAATGTAACTTCTGTTGCTGTTCACGGTCAGGGACTATTTTTTCCGGCGGAAGGAAGGCTTTTAGTGAAAGTTTACTTCATGAAAGTTGCATTGATACATATTTTTGGCTTTAATATTTGTATTGTGTGGTAACCGTTTTATAAAAGCAATAAGGTACTTGAGGCTAGTGCTGTATCGTGAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU519879 True 211 lncRNA 0.38 1 5582351 5582561

Neighbor

gene id symbol gene type direction distance location
CI01000319_05435510_05450379 NA coding upstream 131719 5435229 ~ 5450632 (+)
CI01000319_05112104_05116909 NA coding upstream 465277 5111633 ~ 5117074 (+)
CI01000319_04949418_04952350 PDK2B coding upstream 630001 4949305 ~ 4952350 (+)
CI01000319_04931863_04933044 NA coding upstream 649265 4931653 ~ 4933086 (+)
CI01000319_04907275_04915465 WIPF2B coding upstream 666755 4907006 ~ 4915596 (+)
CI01000319_05618356_05625888 FLOT1, FLOT1A coding downstream 35795 5618356 ~ 5626767 (+)
CI01000319_05651284_05669061 KIFC1, ZBTB22B coding downstream 68553 5651114 ~ 5671460 (+)
CI01000319_05684798_05685353 NA coding downstream 101855 5684416 ~ 5685353 (+)
CI01000319_05704764_05712826 NA coding downstream 121522 5704083 ~ 5713885 (+)
CI01000319_05718732_05734284 NA coding downstream 135771 5718332 ~ 5734843 (+)
G452690 NA non-coding upstream 20307 5561770 ~ 5562044 (+)
G452712 NA non-coding upstream 40677 5541467 ~ 5541674 (+)
G452711 NA non-coding upstream 41516 5540455 ~ 5540835 (+)
G452710 NA non-coding upstream 42109 5540023 ~ 5540242 (+)
G452709 NA non-coding upstream 42639 5539370 ~ 5539712 (+)
G452805 NA non-coding downstream 4225 5586786 ~ 5588895 (+)
G452705 NA non-coding downstream 10843 5593404 ~ 5654938 (+)
G452769 NA non-coding downstream 92867 5675428 ~ 5678025 (+)
G452735 NA non-coding downstream 128332 5712686 ~ 5712732 (+)
G452820 NA non-coding downstream 156532 5739093 ~ 5739474 (+)
G452543 NA other upstream 210867 5359700 ~ 5371484 (+)
G452545 NA other upstream 226316 5353694 ~ 5356035 (+)
G452541 NA other upstream 235357 5336085 ~ 5353023 (+)
CI01000319_04787066_04788609 EIF1B, EIF1, GM6900 other upstream 791822 4787040 ~ 4790529 (+)
CI01000319_04515268_04534770 NA other upstream 1046326 4515268 ~ 4536025 (+)
G452884 NA other downstream 540083 6122644 ~ 6124939 (+)

Expression


Co-expression Network