G452784


Basic Information

Item Value
gene id G452784
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 5966890 ~ 5967329 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU519859
CTCTCCTGCATTGGGTTTCAGAGGGGAAAGCTTCTCTCCTGGGGTGTCTATCTCAGCAATAGTCAGGGCACAAGCACGTCCAAACACAACCAGATCCAGCAGTGAGTTGGCGCCCAGGCGGTTGGCACCATGCACTGACGCACAGCCGGCCTCTCCACAGGCGTACAGGCCTGGCACCACCTTATCCTCTCCATCCTTATGGGTGATGACCTGTGAGGATTACAGACAGGATATTAGCATTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU519859 True 243 lncRNA 0.55 2 5966890 5967329

Neighbor

gene id symbol gene type direction distance location
CI01000319_05887712_05890105 HSD17B8 coding upstream 76096 5887518 ~ 5890794 (+)
CI01000319_05882023_05885700 NA coding upstream 81085 5882023 ~ 5885805 (+)
CI01000319_05872448_05880610 BRD2A, BRD2 coding upstream 86280 5871950 ~ 5880610 (+)
CI01000319_05828294_05834113 NA coding upstream 131805 5828007 ~ 5835085 (+)
CI01000319_05816948_05819499 PSMB8F coding upstream 147391 5816825 ~ 5819499 (+)
CI01000319_05974099_05976045 CCDC127B coding downstream 6770 5974099 ~ 5976055 (+)
CI01000319_05978795_05979500 NA coding downstream 10866 5978195 ~ 5979549 (+)
CI01000319_05981549_05984687 NA coding downstream 14220 5981549 ~ 5985215 (+)
CI01000319_06031126_06031401 NA coding downstream 63797 6031126 ~ 6033230 (+)
CI01000319_06044073_06049600 NA coding downstream 76744 6044073 ~ 6049961 (+)
G452798 NA non-coding upstream 15679 5947541 ~ 5951211 (+)
G452826 NA non-coding upstream 110281 5856405 ~ 5856609 (+)
G452825 NA non-coding upstream 111692 5854955 ~ 5855198 (+)
CI01000319_05796587_05803719 ABCB3L2 non-coding upstream 163192 5793688 ~ 5804150 (+)
G452856 NA non-coding downstream 18379 5985708 ~ 5986065 (+)
G452880 NA non-coding downstream 84038 6051367 ~ 6051568 (+)
G452760 NA non-coding downstream 91220 6058549 ~ 6060505 (+)
G452881 NA non-coding downstream 95689 6063018 ~ 6064372 (+)
G452768 NA non-coding downstream 118510 6085839 ~ 6088623 (+)
G452735 NA other upstream 233954 5712686 ~ 5712732 (+)
G452543 NA other upstream 595406 5359700 ~ 5371484 (+)
G452545 NA other upstream 610855 5353694 ~ 5356035 (+)
G452541 NA other upstream 619896 5336085 ~ 5353023 (+)
CI01000319_04787066_04788609 EIF1B, EIF1, GM6900 other upstream 1176361 4787040 ~ 4790529 (+)
G452884 NA other downstream 155315 6122644 ~ 6124939 (+)

Expression


Co-expression Network