G453830


Basic Information

Item Value
gene id G453830
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000319
NCBI id null
chromosome length 6428943
location 6388428 ~ 6388654 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU521027
AGATGGCAGGCAAGTTGCGACATGCGACGGGAGCGTAGACCACCCTGATGGTTGATGTACGCAACGGCCGCAGTGCTGTCCGAGCGGACCAGTACGTGCTTGTCTGTCAACAGCTCCTTGAAGCGGCCCAGTGCAAGACGTACTGCTAGCAACTCGAGGCAATTGATATGCCAATGCAGTTGAGGCCCGGTCCACAGACCTGACACTGCATGCCCGTTGTACGTGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU521027 True 227 lncRNA 0.58 1 6388428 6388654

Neighbor

gene id symbol gene type direction distance location
CI01000319_06373867_06384385 NA coding upstream 3957 6373484 ~ 6384471 (+)
CI01000319_06331800_06332394 NA coding upstream 56025 6331800 ~ 6332403 (+)
CI01000319_06321729_06328918 NA coding upstream 58774 6321729 ~ 6329654 (+)
CI01000319_06316911_06319511 CKS1B.L, BRAFLDRAFT_59154, CKS1, CKS1B, CKS1B.S, CKS2 coding upstream 68859 6316836 ~ 6319569 (+)
CI01000319_06299220_06303590 AQP10B coding upstream 84189 6299220 ~ 6304239 (+)
CI01000319_06396614_06408857 NA coding downstream 7566 6396220 ~ 6409348 (+)
G452895 NA non-coding upstream 158480 6229616 ~ 6229948 (+)
G452782 NA non-coding upstream 270243 6116267 ~ 6118185 (+)
G453837 NA non-coding downstream 27888 6416542 ~ 6416742 (+)
G452884 NA other upstream 263489 6122644 ~ 6124939 (+)
G452735 NA other upstream 655492 5712686 ~ 5712732 (+)
G452543 NA other upstream 1016944 5359700 ~ 5371484 (+)
G452545 NA other upstream 1032393 5353694 ~ 5356035 (+)
G452541 NA other upstream 1041434 5336085 ~ 5353023 (+)

Expression


Co-expression Network