CI01000321_04748037_04748315 (DPM3)


Basic Information

Item Value
gene id CI01000321_04748037_04748315
gene name DPM3
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 4747650 ~ 4749579 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000321_04748037_04748315.mRNA
TTTTAAAAAAACGCCTGTGTATTTCTTTTTTTCCCCCTGTACTATTTATTTCGTTATCTTCCGATTTCGCCTGTCTCAAGCAGTAGCTCTAGAAATTGTGACTGTCAGTTTTAATCTAAAGCTCTGCAAGAAATAGTTTAATAATTAAATGTAAGCACATTAATAAGTACATTTTTATTTTTGATGTAAAACATTCGTACAGTGTTCTATGTACTGCCAAATCTAAATGGCCACTTTGACATTAGCCTAATAAAGAAAAACAGTGTGCGTCATCTAAAAGTATACATGTTAAACAGTATTATCTAACCTTACAGAAGCATATTTATCCTCATAGGTGGATTCTTCAGCTATAATTTTGCCCTCCACCGTCCCACAATCCTCTGAACCATGACCAAGCTTCTGGAGTGGCTTCTTGGAGTGTCACTGATTGGCATTTCATGGGGACTCGTTACCTTTGACCTTCTTGATTTGCAGCTGCCTCCCCAGTATAAAGAGATGGCGTGGCCGATGCCTGTATATCTGCTGGTGGCGTTTGGGTGTTACTCTTTGGCAACTGTCGGTTACCGTGTGGCCACATTTAATGACTGTGAGGACGCAGCCAAAGAGCTGCAAGCGCAAATAAAGGAAGCCAAAGAGGACTTGAAGAAGAAGGGACTGAAGATGTGAAAA

Function

symbol description
dpm3 Acts upstream of or within muscle structure development. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Predicted to be part of dolichol-phosphate-mannose synthase complex. Predicted to be integral component of endoplasmic reticulum membrane. Is expressed in brain; cloaca; pronephric duct; solid lens vesicle; and vertical myoseptum. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation and muscular dystrophy-dystroglycanopathy. Orthologous to human DPM3 (dolichyl-phosphate mannosyltransferase subunit 3, regulatory).

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
K09659 DPM3; dolichol-phosphate mannosyltransferase subunit 3

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000321_04748037_04748315.mRNA False 669 mRNA 0.40 1 4747650 4748318

Neighbor

gene id symbol gene type direction distance location
CI01000321_04716387_04724423 TRIM46, TRIM46B coding upstream 22884 4716387 ~ 4724766 (+)
CI01000321_04649973_04674616 CHRNA7 coding upstream 72719 4649973 ~ 4674931 (+)
CI01000321_04635524_04639904 RPS27.1, RPS27, RPS27.2, RPS27.L, RPS27L coding upstream 107555 4635524 ~ 4640144 (+)
CI01000321_04605557_04620142 NA coding upstream 127252 4604965 ~ 4620398 (+)
CI01000321_04567844_04592431 CELF3, CELF3A coding upstream 155079 4567844 ~ 4592571 (+)
CI01000321_04774523_04814193 NA coding downstream 25521 4773839 ~ 4814239 (+)
CI01000321_04859626_04859952 NA coding downstream 110677 4858995 ~ 4860916 (+)
CI01000321_05000584_05005208 NA coding downstream 252266 5000584 ~ 5005379 (+)
CI01000321_05126875_05128453 NA coding downstream 378075 5126393 ~ 5129935 (+)
G459231 NA non-coding upstream 36202 4710432 ~ 4711448 (+)
G459240 NA non-coding upstream 46701 4696671 ~ 4700949 (+)
G459225 NA non-coding upstream 249538 4495458 ~ 4498112 (+)
G459239 NA non-coding upstream 286968 4451626 ~ 4460682 (+)
G459682 NA non-coding downstream 98038 4846356 ~ 4846583 (+)
G459683 NA non-coding downstream 99629 4847947 ~ 4848156 (+)
G459785 NA non-coding downstream 264354 5012672 ~ 5013312 (+)
G459792 NA non-coding downstream 270592 5018910 ~ 5025813 (+)
G459812 NA non-coding downstream 287029 5035347 ~ 5035939 (+)
CI01000321_04515562_04517953 MRPS21 other upstream 229463 4515534 ~ 4518187 (+)
G459303 NA other upstream 259098 4485397 ~ 4488552 (+)
CI01000321_04013470_04014515 CACNG8 other upstream 733984 4013468 ~ 4015412 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other upstream 944768 3792915 ~ 3805511 (+)
CI01000321_00815160_00819665 NA other upstream 3924803 815160 ~ 819749 (+)

Expression


Co-expression Network