G456730


Basic Information

Item Value
gene id G456730
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 315397 ~ 315865 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU524292
CGCAAACAATCTGATATCACTTGGAAAACTTTATTTGAAAAACAGCTTATTTCAAAACTTAAAAATTTTAAGTTACAACACTTCTTATTTGTTTCTCTTGCTTGGCTTCCTCCTCCTCTTGTTCCTCTTCTTCTTTTTCTTTCTTTCCACTGATGAATCTTAAGAGGGAATCCCATACAAACGGCACATACAGCAATAACTACAGTAATCCATACGACCCCAATGGATGAATCAATGTCTTCTGAAGTGAAATGATACGTATTTGTAAGAAAAATACCAAATATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU524292 True 286 lncRNA 0.33 2 315397 315865

Neighbor

gene id symbol gene type direction distance location
CI01000321_00283589_00284224 NA coding upstream 31060 283324 ~ 284337 (+)
CI01000321_00150756_00152124 NA coding upstream 163208 150756 ~ 152189 (+)
CI01000321_00098493_00100489 NA coding upstream 214811 98296 ~ 100586 (+)
CI01000321_00326486_00355049 NA coding downstream 10528 326393 ~ 355202 (+)
CI01000321_00441382_00448773 RPS18.L, GM10260, RPS18, RPS18-PS3, GM6630, BRAFLDRAFT_114927, GM11361, RPS18P5 coding downstream 125517 441382 ~ 448780 (+)
CI01000321_00511077_00516356 NA coding downstream 194689 510554 ~ 516356 (+)
CI01000321_00549095_00550611 NA coding downstream 233230 549095 ~ 550648 (+)
CI01000321_00559268_00567811 NA coding downstream 243403 559268 ~ 568138 (+)
G456725 NA non-coding upstream 9174 305966 ~ 306223 (+)
G456711 NA non-coding upstream 13327 301793 ~ 302070 (+)
G456691 NA non-coding upstream 51562 263583 ~ 263835 (+)
G456689 NA non-coding upstream 52144 262882 ~ 263253 (+)
G456589 NA non-coding upstream 120911 194227 ~ 194486 (+)
G456751 NA non-coding downstream 9560 325425 ~ 325637 (+)
G456759 NA non-coding downstream 18403 334268 ~ 334476 (+)
G456760 NA non-coding downstream 18918 334783 ~ 334993 (+)
G456763 NA non-coding downstream 22410 338275 ~ 338501 (+)
G456780 NA non-coding downstream 76327 392192 ~ 392416 (+)
G456774 NA other downstream 110218 426083 ~ 427025 (+)
CI01000321_00815160_00819665 NA other downstream 502599 815160 ~ 819749 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other downstream 3473453 3792915 ~ 3805511 (+)
CI01000321_04013470_04014515 CACNG8 other downstream 3690761 4013468 ~ 4015412 (+)
G459303 NA other downstream 4169532 4485397 ~ 4488552 (+)

Expression


Co-expression Network