G456806


Basic Information

Item Value
gene id G456806
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 544844 ~ 545111 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU524371
CACCATTACCGATCTCCTCTATGAAAGGAAGGTGAAACTTGTCATTCCAGCATTTACCAAGAGAGGCATGCAACTCTCCGAAGAAGACACCAACAACACCAGGCACATCGCCAAGTGGATATATGACTGAAAAACTTCAAAATCCTTTCTTACAACAGTTCCAATTAACCTCACCCCTAAAATTGATAACATTTAGAGAATTTGCCCTGTGTAACTTTCTAAGCAACATAATTTTTTATGAAGAGGATGAATAATGTGCGTTCCACGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU524371 True 268 lncRNA 0.39 1 544844 545111

Neighbor

gene id symbol gene type direction distance location
CI01000321_00511077_00516356 NA coding upstream 28488 510554 ~ 516356 (+)
CI01000321_00441382_00448773 RPS18.L, GM10260, RPS18, RPS18-PS3, GM6630, BRAFLDRAFT_114927, GM11361, RPS18P5 coding upstream 96064 441382 ~ 448780 (+)
CI01000321_00326486_00355049 NA coding upstream 189642 326393 ~ 355202 (+)
CI01000321_00283589_00284224 NA coding upstream 260507 283324 ~ 284337 (+)
CI01000321_00150756_00152124 NA coding upstream 392655 150756 ~ 152189 (+)
CI01000321_00549095_00550611 NA coding downstream 3984 549095 ~ 550648 (+)
CI01000321_00559268_00567811 NA coding downstream 14157 559268 ~ 568138 (+)
CI01000321_00649226_00658653 NA coding downstream 104115 649226 ~ 658950 (+)
CI01000321_00697882_00700283 CCK coding downstream 151955 697066 ~ 700313 (+)
CI01000321_00785868_00790038 CTNNB1, CTNNB2 coding downstream 240757 785868 ~ 791009 (+)
G456805 NA non-coding upstream 5150 534430 ~ 539694 (+)
G456800 NA non-coding upstream 49363 495235 ~ 495481 (+)
G456798 NA non-coding upstream 51037 493340 ~ 493807 (+)
G456795 NA non-coding upstream 56535 487957 ~ 488309 (+)
G456793 NA non-coding upstream 57356 486803 ~ 487488 (+)
G456842 NA non-coding downstream 87613 632724 ~ 633919 (+)
G456867 NA non-coding downstream 171588 716699 ~ 718214 (+)
G456868 NA non-coding downstream 190076 735187 ~ 736481 (+)
G456911 NA non-coding downstream 256549 801660 ~ 801879 (+)
G456912 NA non-coding downstream 257049 802160 ~ 802388 (+)
G456774 NA other upstream 117819 426083 ~ 427025 (+)
CI01000321_00815160_00819665 NA other downstream 273353 815160 ~ 819749 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other downstream 3244207 3792915 ~ 3805511 (+)
CI01000321_04013470_04014515 CACNG8 other downstream 3461515 4013468 ~ 4015412 (+)
G459303 NA other downstream 3940286 4485397 ~ 4488552 (+)
CI01000321_04515562_04517953 MRPS21 other downstream 3970423 4515534 ~ 4518187 (+)

Expression


Co-expression Network