G458126



Basic Information


Item Value
gene id G458126
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 1046446 ~ 1046664 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU525913
CATACACAATAATGATGAACTCAAAGACTAACAGGTGGGATCATTAAATGAGTGTCCTAATGACTGGCAGGAACAAAGGAACACAGGAAACAGATAACTGAAAGTCCAATATGAAAATTAAACCAAAACAGGCAAACATCACAGACTAGGTAAAACTCCACCCATTATGTCCAGAGAATCCAAGAAGTATTTTGGTTTCTAGTAGCAATTTTTAGTAGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU525913 True 219 lncRNA 0.37 1 1046446 1046664

Neighbor


gene id symbol gene type direction distance location
CI01000321_01019890_01027358 NA coding downstream 19088 1019744 ~ 1027358 (-)
CI01000321_00962639_00981042 SMARCC1, SMARCC1A coding downstream 65227 962230 ~ 981219 (-)
CI01000321_00922020_00945388 NA coding downstream 101058 921501 ~ 945388 (-)
CI01000321_00822740_00840482 DYNC1LI1 coding downstream 205964 822456 ~ 840482 (-)
CI01000321_00737310_00746720 CFAP44 coding downstream 299726 737209 ~ 746720 (-)
CI01000321_01057908_01060166 NA coding upstream 11066 1057730 ~ 1060497 (-)
CI01000321_01090482_01118656 TAX1BP1A coding upstream 42324 1088988 ~ 1118690 (-)
CI01000321_01174323_01177482 EVX1 coding upstream 126803 1173467 ~ 1179886 (-)
CI01000321_01285727_01288625 SNX10A coding upstream 238928 1285592 ~ 1288625 (-)
CI01000321_01290633_01292869 NA coding upstream 243471 1290135 ~ 1292936 (-)
G458064 NA non-coding downstream 45550 996819 ~ 1000896 (-)
G458059 NA non-coding downstream 146339 886796 ~ 900107 (-)
G458081 NA non-coding downstream 162642 883271 ~ 883804 (-)
G458076 NA non-coding downstream 175250 870866 ~ 871196 (-)
G458074 NA non-coding downstream 178007 864618 ~ 868439 (-)
G458128 NA non-coding upstream 17006 1063670 ~ 1064011 (-)
G458129 NA non-coding upstream 19538 1066202 ~ 1066558 (-)
G458166 NA non-coding upstream 150620 1197284 ~ 1197528 (-)
G458102 NA non-coding upstream 196824 1243488 ~ 1244431 (-)
G458177 NA non-coding upstream 218847 1265511 ~ 1265768 (-)
G458122 NA other downstream 10298 1032063 ~ 1036148 (-)
G456607 NA other downstream 947251 96116 ~ 99195 (-)
G456609 NA other downstream 1006506 39518 ~ 39940 (-)
G456597 NA other downstream 1019173 25639 ~ 27273 (-)
CI01000321_01451689_01453423 NPY other upstream 404530 1451194 ~ 1453530 (-)
CI01000321_02282824_02284376 MBPA other upstream 1226381 2282238 ~ 2284934 (-)
CI01000321_03044953_03048124 NA other upstream 1941476 3044880 ~ 3048203 (-)
G458802 NA other upstream 2041451 3088115 ~ 3091927 (-)
G458859 NA other upstream 2425217 3471881 ~ 3489534 (-)

Expression



Co-expression Network