G458129


Basic Information

Item Value
gene id G458129
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 1066202 ~ 1066558 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU525923
TTGAAATAACTAGCTTCCGGCGGACGACCATACACAGAATGTGCAAGTCGACTTTTGCGCCAAATGAGTAATCCTCTGAGGCGATGTATGACGCAGGATGTAGGAGTATTGTAAATGCCTCTCGGGGTTAAAACAAATAGGGCTGTGCGACAAATTTAAGCTCCTCTTCTCTTATATCAAAATCCTCCGTCCTTTCTCTTTAAAAATGATCGTTTTAGACTTATAATCTGTGACTGGTGATTTGTTTTGCTCTATCTTCTGCACCTCCACATTCGTCATTATGTTTTGCGTCAGGTCAAAGGATACTCTTCCACTGCAAATTGTCTTGCACATTCTGCGTATGGTCGTCCGTCGGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU525923 True 357 lncRNA 0.43 1 1066202 1066558

Neighbor

gene id symbol gene type direction distance location
CI01000321_01057908_01060166 NA coding downstream 5705 1057730 ~ 1060497 (-)
CI01000321_01019890_01027358 NA coding downstream 38844 1019744 ~ 1027358 (-)
CI01000321_00962639_00981042 SMARCC1, SMARCC1A coding downstream 84983 962230 ~ 981219 (-)
CI01000321_00922020_00945388 NA coding downstream 120814 921501 ~ 945388 (-)
CI01000321_00822740_00840482 DYNC1LI1 coding downstream 225720 822456 ~ 840482 (-)
CI01000321_01090482_01118656 TAX1BP1A coding upstream 22430 1088988 ~ 1118690 (-)
CI01000321_01174323_01177482 EVX1 coding upstream 106909 1173467 ~ 1179886 (-)
CI01000321_01285727_01288625 SNX10A coding upstream 219034 1285592 ~ 1288625 (-)
CI01000321_01290633_01292869 NA coding upstream 223577 1290135 ~ 1292936 (-)
CI01000321_01297595_01298913 CBX3A, CBX3, CBX3.S coding upstream 230587 1297145 ~ 1298913 (-)
G458128 NA non-coding downstream 2191 1063670 ~ 1064011 (-)
G458126 NA non-coding downstream 19538 1046446 ~ 1046664 (-)
G458064 NA non-coding downstream 65306 996819 ~ 1000896 (-)
G458059 NA non-coding downstream 166095 886796 ~ 900107 (-)
G458081 NA non-coding downstream 182398 883271 ~ 883804 (-)
G458166 NA non-coding upstream 130726 1197284 ~ 1197528 (-)
G458102 NA non-coding upstream 176930 1243488 ~ 1244431 (-)
G458177 NA non-coding upstream 198953 1265511 ~ 1265768 (-)
G458178 NA non-coding upstream 200086 1266644 ~ 1266887 (-)
G458188 NA non-coding upstream 245018 1311576 ~ 1350433 (-)
G458122 NA other downstream 30054 1032063 ~ 1036148 (-)
G456607 NA other downstream 967007 96116 ~ 99195 (-)
G456609 NA other downstream 1026262 39518 ~ 39940 (-)
G456597 NA other downstream 1038929 25639 ~ 27273 (-)
CI01000321_01451689_01453423 NPY other upstream 384636 1451194 ~ 1453530 (-)
CI01000321_02282824_02284376 MBPA other upstream 1206487 2282238 ~ 2284934 (-)
CI01000321_03044953_03048124 NA other upstream 1921582 3044880 ~ 3048203 (-)
G458802 NA other upstream 2021557 3088115 ~ 3091927 (-)
G458859 NA other upstream 2405323 3471881 ~ 3489534 (-)

Expression


Co-expression Network