G457109


Basic Information

Item Value
gene id G457109
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 1390918 ~ 1391184 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU524726
CTTAAGTAGTGCTACAGTGTTGTCACATGACAAACATTGAACATTAATTCAGCACAGCTGTGCAGGTTGTTACCTTACAAATAAATGCGCTAACCATTCTTTTTATGTGCAAACCTGAGTGAAAATGTTCTACCTTTCAGCTGTCCTCACCAATGGTCTTGATCTAACCCATAAAAATTCTGTTTGTTGGTGTAAAATCCAGTTGATTTGGTGAAATGATCTTTTTTACTTAAAATCAGTTGTTTAGATTTTATTTTTCTCGACAAA

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU524726 True 267 lncRNA 0.34 1 1390918 1391184

Neighbor

gene id symbol gene type direction distance location
CI01000321_01362387_01381302 OSBPL3, OSBPL3A coding upstream 8261 1362387 ~ 1382657 (+)
CI01000321_01348009_01350252 NA coding upstream 39144 1348009 ~ 1351774 (+)
CI01000321_01342947_01344272 NPVF coding upstream 46307 1342900 ~ 1344611 (+)
CI01000321_01242644_01243808 HOXA1A, HOXA1 coding upstream 146505 1241961 ~ 1244413 (+)
CI01000321_01238511_01240051 NA coding upstream 150592 1238374 ~ 1240326 (+)
CI01000321_01411682_01416499 NA coding downstream 20498 1411682 ~ 1416536 (+)
CI01000321_01473475_01476619 CCDC126 coding downstream 82291 1473475 ~ 1477216 (+)
CI01000321_01477590_01479280 NA coding downstream 86406 1477590 ~ 1479280 (+)
CI01000321_01480684_01483493 NA coding downstream 89500 1480684 ~ 1483792 (+)
CI01000321_01491101_01521160 IGF2BP3 coding downstream 99709 1490893 ~ 1521421 (+)
G457108 NA non-coding upstream 864 1389591 ~ 1390054 (+)
G457107 NA non-coding upstream 1689 1388732 ~ 1389229 (+)
G457106 NA non-coding upstream 2231 1388353 ~ 1388687 (+)
G457104 NA non-coding upstream 3931 1386549 ~ 1386987 (+)
G457000 NA non-coding upstream 91071 1295466 ~ 1299847 (+)
G457112 NA non-coding downstream 2357 1393541 ~ 1393741 (+)
G457090 NA non-coding downstream 3202 1394386 ~ 1418110 (+)
G457121 NA non-coding downstream 39045 1430229 ~ 1431421 (+)
G457133 NA non-coding downstream 60093 1451277 ~ 1453283 (+)
G457139 NA non-coding downstream 78159 1469343 ~ 1469544 (+)
CI01000321_00815160_00819665 NA other upstream 568071 815160 ~ 819749 (+)
G456774 NA other upstream 963893 426083 ~ 427025 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other downstream 2398134 3792915 ~ 3805511 (+)
CI01000321_04013470_04014515 CACNG8 other downstream 2615442 4013468 ~ 4015412 (+)
G459303 NA other downstream 3094213 4485397 ~ 4488552 (+)
CI01000321_04515562_04517953 MRPS21 other downstream 3124350 4515534 ~ 4518187 (+)
CI01000321_04748037_04748315 DPM3 other downstream 3356228 4747650 ~ 4749579 (+)

Expression


Co-expression Network