G457473


Basic Information

Item Value
gene id G457473
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 2486901 ~ 2487500 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU525133
AAAAACTTTACAAACATTGTTAATGTAATAAAAACATCTAAAATAGACATTAAAAGCAAGCTTATTTTACATCGTTTACATTCTTAAATGTACATAAAATATTTTAAATTAGTTTTAAGCAAATTCCTTTTCTGATTAAAAGTCTAATATAAAATTATAATATTTTACATATGCTCCACAATTAAGAATGAATTTTAATAATATCATTAATATCATTTACAGATCCCTTTTTTCAAAGACAATTAGTGTTACATGGGTCACCTGAAATAAAAAAGTCATATATATTGACCAAGGGAAACATAGTCACTGCCCCCAACATTGAGCCCAACTGCACTACTGCTCCACACCACACGAGAGCGCTGTGACCTTCATCTCGCAAGATGACAGCAACAATCACCTTAACGTAGGATAGGACGAAAATAAAAAAGAACCACGCCAACACCTGTAAAACATAGGATTACTAAATATACAAAAAGAAACAATAAAATAGATCAAGCAAAAACACTTCTTATATTAAAAATAAATACAAATTCGTCCTTAATACTCACAATAATGACTGTTCCAGAAGTGTCATTAACAAGCAGTGGACAGGGACTCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU525133 True 600 lncRNA 0.30 1 2486901 2487500

Neighbor

gene id symbol gene type direction distance location
CI01000321_02433523_02469055 NFATC1 coding upstream 17832 2433523 ~ 2469069 (+)
CI01000321_02371786_02421055 ATP9B coding upstream 65202 2371661 ~ 2421699 (+)
CI01000321_02359797_02366314 SALL3B, SALL3 coding upstream 120542 2359797 ~ 2366359 (+)
CI01000321_02306311_02308161 GALR1, GALR1A coding upstream 178699 2306121 ~ 2308202 (+)
CI01000321_02205260_02210288 NA coding upstream 276375 2204517 ~ 2210526 (+)
CI01000321_02508568_02513821 NA coding downstream 21068 2508568 ~ 2513907 (+)
CI01000321_02515869_02522379 NA coding downstream 27846 2515346 ~ 2522484 (+)
CI01000321_02627263_02629887 NA coding downstream 139114 2626614 ~ 2629925 (+)
CI01000321_02720431_02722463 TRHRB coding downstream 232734 2720234 ~ 2723126 (+)
CI01000321_02771823_02809283 NA coding downstream 283762 2771262 ~ 2809420 (+)
G457471 NA non-coding upstream 1264 2485416 ~ 2485637 (+)
G457460 NA non-coding upstream 59713 2426920 ~ 2427188 (+)
G457440 NA non-coding upstream 166534 2320005 ~ 2320367 (+)
G457439 NA non-coding upstream 167246 2319408 ~ 2319655 (+)
G457431 NA non-coding upstream 189168 2297494 ~ 2297733 (+)
G457474 NA non-coding downstream 335 2487835 ~ 2489055 (+)
G457477 NA non-coding downstream 4719 2492219 ~ 2492553 (+)
G457478 NA non-coding downstream 5619 2493119 ~ 2493444 (+)
G457494 NA non-coding downstream 59631 2547131 ~ 2547395 (+)
G457495 NA non-coding downstream 60143 2547643 ~ 2547901 (+)
CI01000321_00815160_00819665 NA other upstream 1664054 815160 ~ 819749 (+)
G456774 NA other upstream 2059876 426083 ~ 427025 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other downstream 1301818 3792915 ~ 3805511 (+)
CI01000321_04013470_04014515 CACNG8 other downstream 1519126 4013468 ~ 4015412 (+)
G459303 NA other downstream 1997897 4485397 ~ 4488552 (+)
CI01000321_04515562_04517953 MRPS21 other downstream 2028034 4515534 ~ 4518187 (+)
CI01000321_04748037_04748315 DPM3 other downstream 2259912 4747650 ~ 4749579 (+)

Expression


Co-expression Network