G458777


Basic Information

Item Value
gene id G458777
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 2953067 ~ 2953908 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU526643
GTTTATTTGCAGGAACACGCAGAAAGTCTCCCATAATTCTCTGTTTGAAGAGGCCTCCTTGCTCGATCTTGTGTGATGTCAATGAAGGGTTCACACCAACCACATTGGAAGCATTGATCTGGTTAACATTATTAAAAAAAATGCTGATTTCCAGGGTTGGTGAGCCATTGGATGTACCAGCTGTAGCCTCTACAGTCTCCATATCTCTGCACCTGCAGCTGGCCGAGCTCTGGGATCCCCTGCAGGGCGTACTGCAGGTCCGCAGCACTGATGTCTACCGCCAGGCCTGGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU526643 True 292 lncRNA 0.50 2 2953067 2953908

Neighbor

gene id symbol gene type direction distance location
CI01000321_02739755_02767802 NUDCD1 coding downstream 185099 2739482 ~ 2767968 (-)
CI01000321_02702079_02702974 NA coding downstream 250093 2701859 ~ 2702974 (-)
CI01000321_02671166_02689684 EIF3E.L, EIF3EB, EIF3E, EIF3E.S, EIF3EA coding downstream 263325 2670522 ~ 2689742 (-)
CI01000321_02656580_02666438 NA coding downstream 286629 2656571 ~ 2666438 (-)
CI01000321_02606321_02610175 NA coding downstream 342502 2605975 ~ 2610565 (-)
CI01000321_03028470_03033496 NA coding upstream 74489 3028397 ~ 3034891 (-)
CI01000321_03044953_03048124 NA coding upstream 90972 3044880 ~ 3048203 (-)
CI01000321_03067511_03106086 GRB10B, GRB10, GRB10A coding upstream 112832 3066740 ~ 3106086 (-)
CI01000321_03196013_03203541 NA coding upstream 242042 3195950 ~ 3203688 (-)
CI01000321_03319309_03319938 NA coding upstream 364695 3318603 ~ 3321335 (-)
G458756 NA non-coding downstream 58325 2893806 ~ 2894742 (-)
G458752 NA non-coding downstream 62695 2887067 ~ 2890372 (-)
G458687 NA non-coding downstream 228378 2722036 ~ 2724689 (-)
G458686 NA non-coding downstream 231621 2720138 ~ 2721446 (-)
G458682 NA non-coding downstream 237673 2715107 ~ 2715394 (-)
G458814 NA non-coding upstream 97864 3051772 ~ 3052354 (-)
G458820 NA non-coding upstream 177239 3131147 ~ 3131363 (-)
G458821 NA non-coding upstream 180512 3134420 ~ 3134629 (-)
G458829 NA non-coding upstream 192842 3146750 ~ 3147074 (-)
G458830 NA non-coding upstream 196665 3150573 ~ 3151271 (-)
CI01000321_02282824_02284376 MBPA other downstream 668556 2282238 ~ 2284934 (-)
CI01000321_01451689_01453423 NPY other downstream 1499760 1451194 ~ 1453530 (-)
G458122 NA other downstream 1916919 1032063 ~ 1036148 (-)
G456607 NA other downstream 2853872 96116 ~ 99195 (-)
G456609 NA other downstream 2913127 39518 ~ 39940 (-)
G458802 NA other upstream 134207 3088115 ~ 3091927 (-)
G458859 NA other upstream 517973 3471881 ~ 3489534 (-)
G458957 NA other upstream 707718 3661626 ~ 3666999 (-)
CI01000321_03737149_03737996 TMEM238A other upstream 782548 3736456 ~ 3738096 (-)

Expression


Co-expression Network