G458821



Basic Information


Item Value
gene id G458821
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 3134420 ~ 3134629 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU526715
TATAAAACAGCATTTTTTTTTGGTGTAAACTCTAAAAATAGATCAATCCAAAATGAATGTTTAAGAGCAAACGTGTTGAAGATTAGCCGATGGGCTGTCGATTCATTAAATGATAAGCTATTTCCTCAAAAAAGTGGTTTATTCAGTGTAGTGAAGCCTCTCCTCCATTAAAAAAATGGCCTCTTGTCTCCTTCCCTGTGTAAGTTTGAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU526715 True 210 lncRNA 0.35 1 3134420 3134629

Neighbor


gene id symbol gene type direction distance location
CI01000321_03067511_03106086 GRB10B, GRB10, GRB10A coding downstream 28334 3066740 ~ 3106086 (-)
CI01000321_03044953_03048124 NA coding downstream 86296 3044880 ~ 3048203 (-)
CI01000321_03028470_03033496 NA coding downstream 99529 3028397 ~ 3034891 (-)
CI01000321_02739755_02767802 NUDCD1 coding downstream 366452 2739482 ~ 2767968 (-)
CI01000321_02702079_02702974 NA coding downstream 431446 2701859 ~ 2702974 (-)
CI01000321_03196013_03203541 NA coding upstream 61321 3195950 ~ 3203688 (-)
CI01000321_03319309_03319938 NA coding upstream 183974 3318603 ~ 3321335 (-)
CI01000321_03334483_03334797 NA coding upstream 199489 3334118 ~ 3334797 (-)
CI01000321_03386687_03389140 NA coding upstream 251416 3386045 ~ 3389140 (-)
CI01000321_03389183_03396898 NA coding upstream 254554 3389183 ~ 3396898 (-)
G458820 NA non-coding downstream 3057 3131147 ~ 3131363 (-)
G458814 NA non-coding downstream 82066 3051772 ~ 3052354 (-)
G458777 NA non-coding downstream 180512 2953067 ~ 2953908 (-)
G458756 NA non-coding downstream 239678 2893806 ~ 2894742 (-)
G458752 NA non-coding downstream 244048 2887067 ~ 2890372 (-)
G458829 NA non-coding upstream 12121 3146750 ~ 3147074 (-)
G458830 NA non-coding upstream 15944 3150573 ~ 3151271 (-)
G458833 NA non-coding upstream 21575 3156204 ~ 3158185 (-)
G458838 NA non-coding upstream 35074 3169703 ~ 3169944 (-)
G458840 NA non-coding upstream 49031 3183660 ~ 3183927 (-)
G458802 NA other downstream 42493 3088115 ~ 3091927 (-)
CI01000321_02282824_02284376 MBPA other downstream 849909 2282238 ~ 2284934 (-)
CI01000321_01451689_01453423 NPY other downstream 1681113 1451194 ~ 1453530 (-)
G458122 NA other downstream 2098272 1032063 ~ 1036148 (-)
G458859 NA other upstream 337252 3471881 ~ 3489534 (-)
G458957 NA other upstream 526997 3661626 ~ 3666999 (-)
CI01000321_03737149_03737996 TMEM238A other upstream 601827 3736456 ~ 3738096 (-)
G459011 NA other upstream 675498 3810127 ~ 3816395 (-)
G459803 NA other upstream 1884337 5018966 ~ 5025886 (-)

Expression



Co-expression Network