G457872


Basic Information

Item Value
gene id G457872
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 3722749 ~ 3732110 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU525603
GTGCTTTCATCACTGGGAAGATTTGCCTGCTTGTCTTTGGGTATGAGTTTGAAAAGGGCCTCGCTGAGTTCAATCACTTCAGGTTTTGTGACGTAACCATTCTTGTCCACATCAAACAGTGAGAAGACCCACTCCAGCTTCAAGGTCGACTTGCCTGAGGAGGTCATGTGAAGAGCAACGACATACTCCTTAAAGTCTAATGTTCCATCATCATTGGTGTCAAAGGACCGAAAAACGTGTTGGGCATAGGCCTTGGCATCACTGTCGGGGAAGAATTTGGCATAGATCTCCTCAAACTGTTGTAGTGTGATGCGACCTGTAGGACACTGCTTCTGGAAGTTCTCATACCACTGGGTGATCTCAGCTTCAGAGAACCTGGTGGTCAGCTTGAGGTCATCCACAATCTCTTTGGGAATCCCTCCACTCTGTGCGTTTCCCATGGCTTCCCTGTGGTTGTGGTTTAAGGATGAAG

Function

NR:

description
torsin-1A-interacting protein 2-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU525603 True 472 lncRNA 0.48 3 3722749 3732110

Neighbor

gene id symbol gene type direction distance location
CI01000321_03714795_03718845 NA coding upstream 3664 3714476 ~ 3719085 (+)
CI01000321_03702229_03709660 NA coding upstream 12941 3702088 ~ 3709808 (+)
CI01000321_03680978_03683234 SBK2 coding upstream 39070 3680978 ~ 3683679 (+)
CI01000321_03674424_03676748 NA coding upstream 45745 3674424 ~ 3677004 (+)
CI01000321_03650761_03655489 NA coding upstream 67240 3649366 ~ 3655509 (+)
CI01000321_03739229_03740955 NA coding downstream 7119 3739229 ~ 3740990 (+)
CI01000321_03749658_03759359 U2AF2.S, U2AF2, U2AF2A, U2AF2B coding downstream 17548 3749658 ~ 3759645 (+)
CI01000321_03767896_03783640 CNOT3, CNOT3B coding downstream 35786 3767896 ~ 3783926 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 coding downstream 63191 3792915 ~ 3805511 (+)
CI01000321_03811184_03815473 ZNF865 coding downstream 78185 3810295 ~ 3815631 (+)
G457859 NA non-coding upstream 26544 3692881 ~ 3696205 (+)
G457842 NA non-coding upstream 87269 3631777 ~ 3635480 (+)
G457797 NA non-coding upstream 150622 3507969 ~ 3572127 (+)
G457780 NA non-coding upstream 274490 3384433 ~ 3448259 (+)
G457874 NA non-coding downstream 4336 3736446 ~ 3738593 (+)
G457878 NA non-coding downstream 106197 3838307 ~ 3838532 (+)
G459126 NA non-coding downstream 366911 4099021 ~ 4102339 (+)
G459178 NA non-coding downstream 504394 4236504 ~ 4236726 (+)
CI01000321_00815160_00819665 NA other upstream 2899902 815160 ~ 819749 (+)
G456774 NA other upstream 3295724 426083 ~ 427025 (+)
CI01000321_04013470_04014515 CACNG8 other downstream 274516 4013468 ~ 4015412 (+)
G459303 NA other downstream 753287 4485397 ~ 4488552 (+)
CI01000321_04515562_04517953 MRPS21 other downstream 783424 4515534 ~ 4518187 (+)
CI01000321_04748037_04748315 DPM3 other downstream 1015302 4747650 ~ 4749579 (+)

Expression


Co-expression Network