G459610


Basic Information

Item Value
gene id G459610
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 4701479 ~ 4749581 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU527613
TTGCCTTTCACAACTTCTGTTTCATGCCAACTTTAATGAGAAGCTCAGTAAAACATGAATTAAACACAGTTGAGAATGAATCAGTCTCTATTTTGTATCAAACATACATTTTTGTCATGTGGAATGTCTTTTGAGTAAGTTTTCATCTGTGCATTATTTTCAATACATACACATGTAGGTCATTTCTTTTATTATGGACCACATAAATAAATGGTTTGACCCAAACAGTGCTTTAAAGGATTAGTTCACTTTAAAATGAAAATTACCCCAAGCTTTACTCACCCTCAAGCCATACTAGGTGTATATGGTGTGTATTCAACTTACAAAAAAAGCGCAACACGTCAGTTAAATTTTTTTCCTAAGTTGAATACGGAAGGCGGTCTGGTGGAAGTTAGATATTTTAATTCATAACTTGTTAAATATGGATATTTTTCTCACAAAAACCCATCGCTTTGCTTCAGGAGGCCTTTATTAACCCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU527613 True 480 lncRNA 0.34 2 4701479 4749581

Neighbor

gene id symbol gene type direction distance location
CI01000321_04514194_04514490 NA coding downstream 186989 4514044 ~ 4514490 (-)
CI01000321_04510676_04512993 CRABP2B, CRABP2 coding downstream 187911 4510361 ~ 4513568 (-)
CI01000321_04496126_04503083 SCAMP3 coding downstream 198396 4495451 ~ 4503083 (-)
CI01000321_04483181_04491284 NA coding downstream 210195 4483120 ~ 4491284 (-)
CI01000321_04444212_04473051 ASH1L coding downstream 228428 4444194 ~ 4473051 (-)
CI01000321_04767177_04772703 EFNA1A coding upstream 17381 4766962 ~ 4772703 (-)
CI01000321_04864287_04872091 EFNA3A, EFNA3 coding upstream 114364 4863945 ~ 4872091 (-)
CI01000321_04965389_04968595 NA coding upstream 214298 4963879 ~ 4969345 (-)
CI01000321_05078234_05124375 NA coding upstream 328311 5077892 ~ 5124437 (-)
CI01000321_05141500_05146892 NA coding upstream 391429 5141010 ~ 5148412 (-)
G459598 NA non-coding downstream 58870 4642303 ~ 4642609 (-)
G459403 NA non-coding downstream 61364 4634865 ~ 4640115 (-)
G459447 NA non-coding downstream 69801 4629578 ~ 4631678 (-)
G459431 NA non-coding downstream 111011 4583022 ~ 4590468 (-)
G459580 NA non-coding downstream 137874 4563397 ~ 4563605 (-)
G459645 NA non-coding upstream 48914 4798495 ~ 4798774 (-)
G459764 NA non-coding upstream 185038 4934619 ~ 4935681 (-)
G459807 NA non-coding upstream 280398 5029979 ~ 5030313 (-)
CI01000321_05151190_05175511 NA non-coding upstream 403876 5150311 ~ 5175511 (-)
G459919 NA non-coding upstream 436763 5186344 ~ 5186707 (-)
G459011 NA other downstream 885084 3810127 ~ 3816395 (-)
CI01000321_03737149_03737996 TMEM238A other downstream 963494 3736456 ~ 3738096 (-)
G458957 NA other downstream 1034480 3661626 ~ 3666999 (-)
G458859 NA other downstream 1211945 3471881 ~ 3489534 (-)
G458802 NA other downstream 1609552 3088115 ~ 3091927 (-)
G459803 NA other upstream 269385 5018966 ~ 5025886 (-)

Expression


Co-expression Network