G463568


Basic Information

Item Value
gene id G463568
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 2565508 ~ 2565770 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU532141
GGAGATCCAGGCCAATAGGCGACGTCACCCACATCCTCCCTACCAACCAGGACAAAGGGTCTGGCTCTCCACACGGGACCTCAAGTTGTGGCTACCAAGTAGAAAACTCAGCCCAAGGCATGTAGGCCCATTTAAAATCTTAAGACAGATTAATGAGGTCACATACCAGTTGGAACTGCCAGCTAACTATCGTGTCTCTCCCTCCTTCCATGTTTCCCTCCTCAAACTGGTCCACCCGGGTGCTGACCCCAACGTCGAGAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU532141 True 263 lncRNA 0.53 1 2565508 2565770

Neighbor

gene id symbol gene type direction distance location
CI01000325_02484476_02491983 KDR coding upstream 73282 2484476 ~ 2492226 (+)
CI01000325_02399892_02431492 NA coding upstream 134016 2399892 ~ 2431492 (+)
CI01000325_02211008_02215705 L3HYPDH coding upstream 349694 2209618 ~ 2215814 (+)
CI01000325_02067666_02085794 ESR2A, ESR2, ERBETA coding upstream 479714 2067666 ~ 2085794 (+)
CI01000325_01944358_01986788 JAG2, JAG2B coding upstream 578720 1944358 ~ 1986788 (+)
CI01000325_02618395_02618952 NA coding downstream 51636 2617406 ~ 2619080 (+)
CI01000325_02751187_02751618 NA coding downstream 184564 2750334 ~ 2751683 (+)
CI01000325_02767014_02793768 LNX1 coding downstream 199807 2762022 ~ 2794226 (+)
CI01000325_02834936_02881751 SCFD2 coding downstream 268646 2834416 ~ 2882034 (+)
CI01000325_02897237_02903784 NA coding downstream 330202 2895972 ~ 2903929 (+)
G463550 NA non-coding upstream 32454 2530234 ~ 2533054 (+)
G463522 NA non-coding upstream 64066 2501181 ~ 2501442 (+)
G463087 NA non-coding upstream 70577 2494576 ~ 2494931 (+)
G463084 NA non-coding upstream 106347 2458585 ~ 2459161 (+)
G463083 NA non-coding upstream 107203 2458106 ~ 2458305 (+)
G463582 NA non-coding downstream 15135 2580905 ~ 2581146 (+)
G463569 NA non-coding downstream 25932 2591702 ~ 2630604 (+)
G463595 NA non-coding downstream 67870 2633640 ~ 2633870 (+)
G463709 NA non-coding downstream 110026 2675796 ~ 2676280 (+)
G463716 NA non-coding downstream 143507 2709277 ~ 2709656 (+)
G463566 NA other upstream 1773 2563155 ~ 2563735 (+)
G462928 NA other upstream 564624 2000477 ~ 2000884 (+)
G462778 NA other upstream 668693 1828082 ~ 1896815 (+)
G462730 NA other upstream 945314 1617596 ~ 1620194 (+)
G463724 NA other downstream 162436 2728206 ~ 2728450 (+)
G464950 NA other downstream 2492686 5058456 ~ 5090938 (+)
CI01000325_05549713_05553140 TMEM251 other downstream 2986350 5549713 ~ 5554577 (+)
CI01000325_05655953_05691697 PRIMA1 other downstream 3089642 5654840 ~ 5692630 (+)
G466144 NA other downstream 3932996 6498766 ~ 6501978 (+)

Expression


Co-expression Network