G463595



Basic Information


Item Value
gene id G463595
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 2633640 ~ 2633870 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU532179
GCAAGGGGCCAGCCTGCGGCCCATCCCGACTGATACAGTGGGTGATTCCCCCCATTCCCAGTAACCAAGCAACACACGGTGAATACTGAAAACTGAAAAGAAACACTCGGGTTTTCAATATAGTCTTCAATAGCAAGGGGAAAATGAACAATGATCCCGCAGACAACATAATGCGGCGCAGTGACTTTTCATTGCCAATTATCTCCTTCATCTGAATAGCAGCTGCAGGGC

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU532179 True 231 lncRNA 0.48 1 2633640 2633870

Neighbor


gene id symbol gene type direction distance location
CI01000325_02618395_02618952 NA coding upstream 14560 2617406 ~ 2619080 (+)
CI01000325_02484476_02491983 KDR coding upstream 141414 2484476 ~ 2492226 (+)
CI01000325_02399892_02431492 NA coding upstream 202148 2399892 ~ 2431492 (+)
CI01000325_02211008_02215705 L3HYPDH coding upstream 417826 2209618 ~ 2215814 (+)
CI01000325_02067666_02085794 ESR2A, ESR2, ERBETA coding upstream 547846 2067666 ~ 2085794 (+)
CI01000325_02751187_02751618 NA coding downstream 116464 2750334 ~ 2751683 (+)
CI01000325_02767014_02793768 LNX1 coding downstream 131707 2762022 ~ 2794226 (+)
CI01000325_02834936_02881751 SCFD2 coding downstream 200546 2834416 ~ 2882034 (+)
CI01000325_02897237_02903784 NA coding downstream 262102 2895972 ~ 2903929 (+)
CI01000325_02968026_02987575 NA coding downstream 334156 2968026 ~ 2988001 (+)
G463569 NA non-coding upstream 3036 2591702 ~ 2630604 (+)
G463582 NA non-coding upstream 52494 2580905 ~ 2581146 (+)
G463568 NA non-coding upstream 67870 2565508 ~ 2565770 (+)
G463550 NA non-coding upstream 100586 2530234 ~ 2533054 (+)
G463522 NA non-coding upstream 132198 2501181 ~ 2501442 (+)
G463709 NA non-coding downstream 41926 2675796 ~ 2676280 (+)
G463716 NA non-coding downstream 75407 2709277 ~ 2709656 (+)
G463725 NA non-coding downstream 94909 2728779 ~ 2728979 (+)
G463727 NA non-coding downstream 97629 2731499 ~ 2731721 (+)
G463731 NA non-coding downstream 108778 2742648 ~ 2742902 (+)
G463566 NA other upstream 69905 2563155 ~ 2563735 (+)
G462928 NA other upstream 632756 2000477 ~ 2000884 (+)
G462778 NA other upstream 736825 1828082 ~ 1896815 (+)
G462730 NA other upstream 1013446 1617596 ~ 1620194 (+)
G463724 NA other downstream 94336 2728206 ~ 2728450 (+)
G464950 NA other downstream 2424586 5058456 ~ 5090938 (+)
CI01000325_05549713_05553140 TMEM251 other downstream 2918250 5549713 ~ 5554577 (+)
CI01000325_05655953_05691697 PRIMA1 other downstream 3021542 5654840 ~ 5692630 (+)
G466144 NA other downstream 3864896 6498766 ~ 6501978 (+)

Expression



Co-expression Network