G465009


Basic Information

Item Value
gene id G465009
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 4614532 ~ 4614735 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU533745
GCTGTAGGAAATTGACTTTGTTCTTTGACGTGAACGTTTAAAGCTGCATGCTGATTGGCTGTTGTCGCATATTTCTGCTGTATGATTGGCTCTTATATTAATCCATATCGAGTAAAAATGCCTAGAGCTTATCATCGTTATCGACATATTTTAGCGCAATTCGATATGATATTGTTTATCGGCACAGCCCTACGCTAGAGCGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU533745 True 204 lncRNA 0.40 1 4614532 4614735

Neighbor

gene id symbol gene type direction distance location
CI01000325_04607642_04612222 CYP2V1 coding upstream 2206 4607449 ~ 4612326 (+)
CI01000325_04559591_04571901 HOOK1 coding upstream 42446 4559591 ~ 4572086 (+)
CI01000325_04530850_04548104 PFAS coding upstream 66398 4530850 ~ 4548134 (+)
CI01000325_04468771_04471223 NA coding upstream 143160 4468525 ~ 4471372 (+)
CI01000325_04443089_04456856 NA coding upstream 157250 4442983 ~ 4457339 (+)
CI01000325_04615595_04620095 NA coding downstream 621 4615356 ~ 4620263 (+)
CI01000325_04620854_04626734 NA coding downstream 5973 4620708 ~ 4627111 (+)
CI01000325_04628834_04636733 CYP2P7, CYP2P8, CYP2P9 coding downstream 13981 4628716 ~ 4637028 (+)
CI01000325_04637289_04640703 CYP2P7, CYP2P8, CYP2J20, CYP2P10, CYP2P9 coding downstream 22386 4637121 ~ 4641092 (+)
CI01000325_04646437_04650931 CYP2P7, CYP2P8, CYP2J20, CYP2P10, CYP2P9 coding downstream 30539 4645274 ~ 4651103 (+)
G464958 NA non-coding upstream 11777 4601664 ~ 4602755 (+)
G464980 NA non-coding upstream 25340 4578171 ~ 4589192 (+)
G464987 NA non-coding upstream 37415 4575791 ~ 4577117 (+)
G464999 NA non-coding upstream 59624 4551544 ~ 4554908 (+)
G464997 NA non-coding upstream 79000 4534955 ~ 4535532 (+)
G465028 NA non-coding downstream 126764 4741499 ~ 4741698 (+)
G464953 NA non-coding downstream 148810 4763545 ~ 4771306 (+)
G465042 NA non-coding downstream 275645 4890380 ~ 4890594 (+)
CI01000325_05257907_05258833 FOXQ1B non-coding downstream 596172 5256693 ~ 5259276 (+)
G465175 NA non-coding downstream 830825 5445560 ~ 5452746 (+)
G463724 NA other upstream 1886082 2728206 ~ 2728450 (+)
G463566 NA other upstream 2050797 2563155 ~ 2563735 (+)
G462928 NA other upstream 2613648 2000477 ~ 2000884 (+)
G462778 NA other upstream 2717717 1828082 ~ 1896815 (+)
G462730 NA other upstream 2994338 1617596 ~ 1620194 (+)
G464950 NA other downstream 443721 5058456 ~ 5090938 (+)
CI01000325_05549713_05553140 TMEM251 other downstream 937385 5549713 ~ 5554577 (+)
CI01000325_05655953_05691697 PRIMA1 other downstream 1040677 5654840 ~ 5692630 (+)
G466144 NA other downstream 1884031 6498766 ~ 6501978 (+)
G466137 NA other downstream 2002465 6617200 ~ 6619471 (+)

Expression


Co-expression Network