CI01000330_03561340_03578253 (KLF13, ZNF746, ZNF467)


Basic Information

Item Value
gene id CI01000330_03561340_03578253
gene name KLF13, ZNF746, ZNF467
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000330
NCBI id null
chromosome length 4651236
location 3561340 ~ 3578253 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000330_03561340_03578253.mRNA
ATGGATCACTTCGCAGCAGAGTGCCTTGTGTCAATGTCCAGCCAAGCAATTGTCCACGGTCCAAAAGGGAATAGAGAGATCAAGCCCGAAACTGCGGCTGCACAGAGGAATGGAGAAGAAACCAAGGAGCCTTTGAAAGACAACTCATCTCTTTTTGTGGTGGCGAGAATTTTGGCGGATTTTAATCAACAGACCCCCACCAATTTTGCCGAGCAGGCAAAAATAAAGGAGGAGAGCACGCCACCAACAGCAACCCTGACCAGAGATGATGGGAACTCTGCCACACCTACCACCATCACCGGCGACTCTGCTCTTAAACAAAGAAACAAACGATTTAGGGGTCGAATTGAACAAGATCCCCCACAGAAAAAGCACAAATGCCACTATTCAGGTTGTGAAAAAGTTTATGGCAAATCGTCCCATCTCAAAGCCCACCTAAGGACACATACAGGAGAGCGCCCCTTTCCTTGCACCTGGCCCGACTGCAGTAAGAAGTTTGCTCGCTCTGATGAGCTGGCACGGCACTATCGCACCCACACGGGCGAGAAGAAGTTCGGCTGCCCCCTGTGCGACAAGCGATTCATGCGGAGTGACCACCTGATGAAACATGCACGCCGCCACTCCGACTTCCAGCCGGCCATGCTGAAGAGGCAGCATGGTGGTGGCAACGTCGCCGTCTCGAGCAGCACACGTCCCGGCTCCCTCAGCGACTACAGTCGATCCGATGCCTCAAGCCCCACCCTAAGCCCCGCCCTCAGCCCAGCCAATTCGCCT

Function

symbol description
klf13 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Orthologous to human KLF13 (Kruppel like factor 13).
znf746 Enables DNA-binding transcription repressor activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and ubiquitin protein ligase binding activity. Involved in negative regulation of transcription by RNA polymerase II; positive regulation of neuron death; and positive regulation of transcription by RNA polymerase II. Located in cytosol and nucleoplasm.
znf467 Predicted to enable DNA-binding transcription activator activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in positive regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be active in nucleus.

GO:

id name namespace
GO:0046872 metal ion binding molecular_function

KEGG:

id description
K09208 KLF9S, BTEB; krueppel-like factor 9/13/14/16

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000330_03561340_03578253.mRNA True 774 mRNA 0.54 2 3561340 3578253

Neighbor

gene id symbol gene type direction distance location
CI01000330_03498678_03499674 NA coding downstream 60677 3498571 ~ 3500663 (-)
CI01000330_03400974_03445121 NA coding downstream 115824 3400097 ~ 3445516 (-)
CI01000330_03388297_03389229 GCNT3 coding downstream 171512 3388208 ~ 3389828 (-)
CI01000330_03378106_03378498 GCNT3 coding downstream 182842 3378017 ~ 3378498 (-)
CI01000330_03363281_03364585 NA coding downstream 196692 3362999 ~ 3364648 (-)
CI01000330_03637151_03648269 RAB8B coding upstream 57962 3636215 ~ 3650583 (-)
CI01000330_03651998_03657102 DNAJA4 coding upstream 73609 3651862 ~ 3658416 (-)
CI01000330_03700374_03704847 IDH3A coding upstream 121433 3699686 ~ 3704847 (-)
CI01000330_03714368_03721994 LRRC61 coding upstream 136029 3714282 ~ 3722123 (-)
CI01000330_03749146_03754161 CASQ2 coding upstream 170101 3748354 ~ 3756146 (-)
G475819 NA non-coding downstream 127580 3432959 ~ 3433760 (-)
G475813 NA non-coding downstream 168495 3390647 ~ 3392845 (-)
G475760 NA non-coding downstream 170989 3337940 ~ 3390351 (-)
G475752 NA non-coding downstream 254506 3276112 ~ 3306834 (-)
G475749 NA non-coding downstream 302819 3258270 ~ 3258521 (-)
G475881 NA non-coding upstream 13158 3591411 ~ 3591631 (-)
G475890 NA non-coding upstream 32985 3611238 ~ 3611527 (-)
G475891 NA non-coding upstream 35190 3613443 ~ 3613713 (-)
G475893 NA non-coding upstream 37541 3615794 ~ 3616041 (-)
G475895 NA non-coding upstream 42803 3621056 ~ 3621494 (-)
G475669 NA other downstream 494404 3066448 ~ 3066936 (-)
G475115 NA other downstream 956594 2602974 ~ 2604746 (-)
CI01000330_01667530_01671493 NA other downstream 1889791 1666058 ~ 1671798 (-)
G474284 NA other downstream 2271371 1289555 ~ 1289969 (-)
CI01000330_01205874_01206632 NA other downstream 2354455 1205267 ~ 1206632 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_024809 NA non-coding NC_007136.7 CM002909.2 34478097 ~ 34512102 (-)
bowfin (Amia calva) AMCG00007807 NA coding CM030123.1 CM030123.1 30810794 ~ 30830616 (-)