G475470


Basic Information

Item Value
gene id G475470
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000330
NCBI id null
chromosome length 4651236
location 3934266 ~ 3934526 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU545574
CACGGCCCCAGGCAGAGAAACTGGCAGGGAGATCCACGGGGAATGAAGGAATATTGTGCACAGGAGCAGTCAGCTTCAAAGCAGGCTTACTGTGCATTATTAAAAGCCTCCTCGACACCTGCACAGTCGGCAGGAGACACAACAGATGCGCAGCGAGGGCAGAAACACACTCTGGGGGCGAATGCATGAATGTATACGTCTACAGCAGGCCGAGCACACACACTGTGCAGGTGCAAGATAAAGATCAAGCCAAGATAGAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU545574 True 261 lncRNA 0.53 1 3934266 3934526

Neighbor

gene id symbol gene type direction distance location
CI01000330_03852880_03865462 DAPK2 coding upstream 68413 3852880 ~ 3865853 (+)
CI01000330_03814548_03834503 TBC1D2B coding upstream 99659 3814295 ~ 3834607 (+)
CI01000330_03779829_03785869 CIB2 coding upstream 147399 3779829 ~ 3786867 (+)
CI01000330_03771375_03773835 ATP5O coding upstream 160326 3770386 ~ 3773940 (+)
CI01000330_03723197_03728117 NA coding upstream 206055 3722943 ~ 3728211 (+)
CI01000330_04011467_04016798 CA12 coding downstream 76941 4011467 ~ 4017357 (+)
CI01000330_04025928_04040081 MAN2C1 coding downstream 91191 4025717 ~ 4040241 (+)
CI01000330_04061721_04074563 NA coding downstream 127195 4061721 ~ 4074621 (+)
CI01000330_04098886_04101731 NA coding downstream 163572 4098098 ~ 4101806 (+)
CI01000330_04109116_04119729 ZNF800A coding downstream 174590 4109116 ~ 4120304 (+)
G475464 NA non-coding upstream 4598 3929443 ~ 3929668 (+)
G475462 NA non-coding upstream 125271 3808781 ~ 3808995 (+)
G475233 NA non-coding upstream 179748 3745011 ~ 3754518 (+)
G475482 NA non-coding downstream 52084 3986610 ~ 3991612 (+)
G476045 NA non-coding downstream 173031 4107557 ~ 4107797 (+)
G476108 NA non-coding downstream 373970 4308496 ~ 4308805 (+)
G476113 NA non-coding downstream 385014 4319540 ~ 4319822 (+)
G476115 NA non-coding downstream 386225 4320751 ~ 4324343 (+)
G475421 NA other upstream 216847 3716544 ~ 3717419 (+)
G475236 NA other upstream 343769 3585475 ~ 3590497 (+)
G475235 NA other upstream 843033 3072547 ~ 3091233 (+)
G474819 NA other upstream 1257824 2675912 ~ 2676442 (+)
CI01000330_02590806_02597446 NA other upstream 1337119 2590091 ~ 2597586 (+)
G475483 NA other downstream 58500 3993026 ~ 3993938 (+)

Expression


Co-expression Network