G477436


Basic Information

Item Value
gene id G477436
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000335
NCBI id null
chromosome length 1176510
location 280924 ~ 281129 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU547868
GGGGCCCAAGACTGGCAGCTTGCACAGGTGAACATGCCGCAGCTGAAGAAGATGATTTGCGGGAGGAAGCGAAGACCCTTCTGAATCGTTTCCCTTCCTACTTCACTCTGGCCACATCCTCCCTTCCCTCCACCCCCCGCCACTTCCTGTCATTAAGCCTCTCACTGCCTGTCCCTAAAATAATCCCAGCAGTTTTTTGTCAATCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU547868 True 206 lncRNA 0.54 1 280924 281129

Neighbor

gene id symbol gene type direction distance location
CI01000335_00193513_00197704 NA coding upstream 83160 191873 ~ 197764 (+)
CI01000335_00149953_00163006 TFEC coding upstream 117385 149953 ~ 163539 (+)
CI01000335_00103583_00132304 NA coding upstream 148495 103472 ~ 132429 (+)
CI01000335_00077557_00081374 CD5L coding upstream 199438 75813 ~ 81486 (+)
CI01000335_00286459_00296460 NA coding downstream 3598 284727 ~ 297256 (+)
CI01000335_00489106_00492720 NA coding downstream 207559 488688 ~ 492973 (+)
CI01000335_00526951_00528066 GPR85.L, GPR85 coding downstream 245822 526951 ~ 537487 (+)
CI01000335_00586957_00597421 TMEM168A coding downstream 305828 586957 ~ 598108 (+)
CI01000335_00681430_00741137 DOCK4B, DOCK4 coding downstream 400301 681430 ~ 741222 (+)
G477435 NA non-coding upstream 1141 279568 ~ 279783 (+)
G477431 NA non-coding upstream 6974 273743 ~ 273950 (+)
G477430 NA non-coding upstream 26689 254021 ~ 254235 (+)
G477422 NA non-coding upstream 69329 210793 ~ 211595 (+)
G477438 NA non-coding downstream 9678 290807 ~ 291031 (+)
G477451 NA non-coding downstream 37237 318366 ~ 318596 (+)
G477453 NA non-coding downstream 39726 320855 ~ 321097 (+)
G477454 NA non-coding downstream 40539 321668 ~ 321907 (+)
G477456 NA non-coding downstream 43633 324762 ~ 324963 (+)
G477502 NA other downstream 268393 549522 ~ 554633 (+)

Expression


Co-expression Network