G477457


Basic Information

Item Value
gene id G477457
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000335
NCBI id null
chromosome length 1176510
location 325125 ~ 325439 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU547892
GGGGTCTTTAAATATTTAAGGTGTGAGTACAATGAGGCAGAGCTGAAATACAAAATACAAACCTGCAAATCATTTACATTTCATTCGCCGTGTCTATTTTACACATACAATTTTTAGGAACAAAATTCCAAAAAAGGAAGATAAATGCACAATATGACAAGCTGTTTGCCGTGAGGTGATTGTCGTAGGTTAGAAACAGATGCTTTTATTCCTCATCATCCCCGAAATCATACACAAAAGGATTAGAATAAAACATCTTTAAAATAGTACACTCTAAAAAATGCTGGGTTAAAAACAACCCAAGTTGGGTTGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU547892 True 315 lncRNA 0.34 1 325125 325439

Neighbor

gene id symbol gene type direction distance location
CI01000335_00286459_00296460 NA coding upstream 27869 284727 ~ 297256 (+)
CI01000335_00193513_00197704 NA coding upstream 127361 191873 ~ 197764 (+)
CI01000335_00149953_00163006 TFEC coding upstream 161586 149953 ~ 163539 (+)
CI01000335_00103583_00132304 NA coding upstream 192696 103472 ~ 132429 (+)
CI01000335_00077557_00081374 CD5L coding upstream 243639 75813 ~ 81486 (+)
CI01000335_00489106_00492720 NA coding downstream 163249 488688 ~ 492973 (+)
CI01000335_00526951_00528066 GPR85.L, GPR85 coding downstream 201512 526951 ~ 537487 (+)
CI01000335_00586957_00597421 TMEM168A coding downstream 261518 586957 ~ 598108 (+)
CI01000335_00681430_00741137 DOCK4B, DOCK4 coding downstream 355991 681430 ~ 741222 (+)
CI01000335_00884515_00888701 NA coding downstream 558899 884338 ~ 888831 (+)
G477456 NA non-coding upstream 162 324762 ~ 324963 (+)
G477454 NA non-coding upstream 3218 321668 ~ 321907 (+)
G477453 NA non-coding upstream 4028 320855 ~ 321097 (+)
G477451 NA non-coding upstream 6529 318366 ~ 318596 (+)
G477438 NA non-coding upstream 34094 290807 ~ 291031 (+)
G477458 NA non-coding downstream 420 325859 ~ 326080 (+)
G477441 NA non-coding downstream 2445 327884 ~ 393126 (+)
G477523 NA non-coding downstream 79614 405053 ~ 406281 (+)
G477489 NA non-coding downstream 198275 523714 ~ 526896 (+)
G477502 NA other downstream 224083 549522 ~ 554633 (+)

Expression


Co-expression Network