G477660


Basic Information

Item Value
gene id G477660
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000335
NCBI id null
chromosome length 1176510
location 890849 ~ 891075 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU548115
GCCAGAGCTGCCCAACAACCAGTATTTTGGGAATAAAATAATCAAGAAGCAGCACACACACTTTCCATGCATCCAATCCTTTGTTTCAGGGACTTTGACAGAAGTACGTCCTCTCTGCTGTGAGCTGACCCTGTTTTCAGGGATGAATTGACTGTGAAGGTGCTTTCCTGAAGTGGAGTTGTCTTGCTTTAAAGCCCATGTCCAGGTCCTTCACAGCTCACCCTCGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU548115 True 227 lncRNA 0.48 1 890849 891075

Neighbor

gene id symbol gene type direction distance location
CI01000335_00884515_00888701 NA coding upstream 2018 884338 ~ 888831 (+)
CI01000335_00681430_00741137 DOCK4B, DOCK4 coding upstream 149627 681430 ~ 741222 (+)
CI01000335_00586957_00597421 TMEM168A coding upstream 292741 586957 ~ 598108 (+)
CI01000335_00526951_00528066 GPR85.L, GPR85 coding upstream 361191 526951 ~ 537487 (+)
CI01000335_00489106_00492720 NA coding upstream 397876 488688 ~ 492973 (+)
CI01000335_00930276_00934328 NA coding downstream 39201 930276 ~ 936380 (+)
CI01000335_00988268_00990978 NA coding downstream 97193 988268 ~ 991337 (+)
CI01000335_01029328_01043603 NA coding downstream 138253 1029328 ~ 1043603 (+)
CI01000335_01055918_01061590 TNNT2D, TNNT2E coding downstream 164843 1055918 ~ 1061716 (+)
CI01000335_01109924_01114152 ELK3 coding downstream 218849 1109924 ~ 1114152 (+)
G477511 NA non-coding upstream 9818 863693 ~ 881031 (+)
G477651 NA non-coding upstream 30052 860503 ~ 860797 (+)
G477636 NA non-coding upstream 72496 818147 ~ 818353 (+)
G477605 NA non-coding upstream 87777 717098 ~ 803072 (+)
G477497 NA non-coding upstream 263559 624798 ~ 627290 (+)
G477668 NA non-coding downstream 12848 903923 ~ 904142 (+)
G477669 NA non-coding downstream 13153 904228 ~ 904453 (+)
G477679 NA non-coding downstream 21111 912186 ~ 912406 (+)
G477681 NA non-coding downstream 24003 915078 ~ 955515 (+)
G477702 NA non-coding downstream 69164 960239 ~ 960575 (+)
G477502 NA other upstream 336216 549522 ~ 554633 (+)

Expression


Co-expression Network