G484684


Basic Information

Item Value
gene id G484684
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 5837573 ~ 5837789 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU556158
ATATGATTTGCCAGTGTCACAACAGTGCTCCCCCCCCCACCCTCGCTCCGTGTGTACACTTGCCTCCGGTGGAGTGTGTACTCTTCTCATGAGATTTTGCCACAAGGATCTAAAGAAATCATTGGATGACTGGGAACATATCCCAGTTGACTCTAAGACGTGCCGGGGAAGAACACAATGGAATTAAGTTCATTTGTTTAGTAGATATCGTTCTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU556158 True 217 lncRNA 0.46 1 5837573 5837789

Neighbor

gene id symbol gene type direction distance location
CI01000339_05832439_05832960 NA coding downstream 4462 5832337 ~ 5833111 (-)
CI01000339_05821180_05830949 SNX19A coding downstream 6624 5820877 ~ 5830949 (-)
CI01000339_05808414_05810066 NA coding downstream 26922 5807441 ~ 5810651 (-)
CI01000339_05639652_05652636 ADAMTS8A coding downstream 184743 5637959 ~ 5652830 (-)
CI01000339_05627087_05634310 ZBTB44 coding downstream 203208 5627087 ~ 5634365 (-)
CI01000339_05853559_05857997 ATF5A coding upstream 15506 5853295 ~ 5857997 (-)
CI01000339_05863897_05897316 PHLDB1A coding upstream 25050 5862839 ~ 5897316 (-)
CI01000339_05917956_05923087 ARCN1 coding upstream 80111 5917900 ~ 5924012 (-)
CI01000339_05932828_05933256 H2AFX, H2AFX.L, HIST1H2AH, HIST1H2AJ coding upstream 94909 5932698 ~ 5933256 (-)
CI01000339_05935601_05965650 C2CD2L coding upstream 97571 5935360 ~ 5965650 (-)
G484683 NA non-coding downstream 510 5836826 ~ 5837063 (-)
G484587 NA non-coding downstream 87618 5749380 ~ 5749955 (-)
G484544 NA non-coding downstream 258411 5578906 ~ 5579162 (-)
G484541 NA non-coding downstream 263009 5574126 ~ 5574564 (-)
G484537 NA non-coding downstream 271164 5566086 ~ 5566409 (-)
G484659 NA non-coding upstream 21019 5858808 ~ 5861203 (-)
G484702 NA non-coding upstream 184039 6021828 ~ 6024822 (-)
G484707 NA non-coding upstream 187214 6025003 ~ 6027258 (-)
G484632 NA non-coding upstream 204018 6041807 ~ 6044025 (-)
G484710 NA non-coding upstream 229703 6067492 ~ 6067961 (-)
G484394 NA other downstream 563303 5274086 ~ 5274270 (-)
G483481 NA other downstream 984126 4851757 ~ 4853447 (-)
G483512 NA other downstream 1218848 4618112 ~ 4618725 (-)
G483509 NA other downstream 1224255 4612852 ~ 4613318 (-)
G483285 NA other downstream 1667071 4125258 ~ 4170502 (-)
G484645 NA other upstream 416542 6254331 ~ 6256112 (-)
G484826 NA other upstream 1163104 7000893 ~ 7004773 (-)

Expression


Co-expression Network