Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_013530

Basic Information

Item	Value
gene id	XLOC_013530
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007129.7
NCBI id	CM002902.2
chromosome length	51023478
location	34886240 ~ 34888072 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00026981
CAAGCACACGGTCAGGACGTTCTGTTAACTTCTTTATGGTGGTTATTCTTGCTTTTTAACAATGCCTCAGAAACAGTGGATGACATCTTAATCACTCATTTCCATCTCATTACTCAGACACCTGTGACCCCTGACCGCACCTCACCTGCAGAACGAGCATGAACCTGCTGAACAAAGCCCTGGTCTCAAAATTGGCCTGTCTGCTCAATGACGAGTTCCCAA

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00026981	True	222	lncRNA	0.46	2	34886240	34888072

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_013529	NA	coding	downstream	331623	34551528 ~ 34554617 (-)
XLOC_013528	ssr3	coding	downstream	336482	34542525 ~ 34549758 (-)
XLOC_013527	NA	coding	downstream	658341	34227352 ~ 34227899 (-)
XLOC_013526	slc33a1	coding	downstream	714960	34158178 ~ 34171280 (-)
XLOC_013525	C18H3orf33	coding	downstream	729448	34146007 ~ 34156792 (-)
XLOC_013531	NA	coding	upstream	363226	35251298 ~ 35254022 (-)
XLOC_013532	CABZ01040999.1	coding	upstream	487157	35375229 ~ 35390735 (-)
XLOC_013533	snrpa	coding	upstream	514687	35402759 ~ 35407790 (-)
XLOC_013534	itpkcb	coding	upstream	541261	35429333 ~ 35459996 (-)
XLOC_013535	ryr1b	coding	upstream	603401	35491473 ~ 35736591 (-)
XLOC_013384	BX323829.1	misc	downstream	15344009	19542102 ~ 19542231 (-)
XLOC_013522	NA	non-coding	downstream	936381	33946342 ~ 33949859 (-)
XLOC_013521	NA	non-coding	downstream	1089628	33782464 ~ 33796612 (-)
XLOC_013520	CU463109.1	non-coding	downstream	1150990	33714357 ~ 33735250 (-)
XLOC_013536	CU138549.1	non-coding	upstream	685109	35573181 ~ 35573295 (-)
XLOC_013541	BX950224.1	non-coding	upstream	1567235	36455307 ~ 36465466 (-)
XLOC_013542	NA	non-coding	upstream	1826567	36714639 ~ 36733902 (-)
XLOC_013543	NA	non-coding	upstream	1961077	36849149 ~ 36887469 (-)

Expression

Co-expression Network