G486406


Basic Information

Item Value
gene id G486406
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 1557273 ~ 1557510 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU558128
GGGCAAAAGGCATCATATTTAACATGATAATAAATAGTTAGCTGACTTTTCCATTTGTTGACATGACATGGTTAAATTCAGATGGTAAATATATATCAAACTAGATATCCACCTTAGAGATCACCATATTTATAATGAAACAATCATATTAAAAAATATTATATTAATCATATCATATAATAAAATATCATGTATTGTTACTACTGTAAATCTATATTAAATTATTATGGGATCTCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU558128 True 238 lncRNA 0.24 1 1557273 1557510

Neighbor

gene id symbol gene type direction distance location
CI01000340_01436981_01473643 PKN2 coding downstream 83630 1436389 ~ 1473643 (-)
CI01000340_01422577_01422959 NA coding downstream 134314 1422463 ~ 1422959 (-)
CI01000340_01400601_01408156 LRRC8C coding downstream 149117 1399456 ~ 1408156 (-)
CI01000340_01385672_01396802 LRRC8DB, LRRC8D coding downstream 158477 1384749 ~ 1398796 (-)
CI01000340_01375418_01382944 ZNF326 coding downstream 174329 1375042 ~ 1382944 (-)
CI01000340_01610308_01614177 NA coding upstream 52720 1610230 ~ 1614911 (-)
CI01000340_01620065_01624298 NA coding upstream 61751 1619261 ~ 1624726 (-)
CI01000340_01785945_01793672 LMO4, LMO4B coding upstream 228317 1785827 ~ 1793954 (-)
CI01000340_01839512_01846883 NA coding upstream 280767 1838277 ~ 1846893 (-)
CI01000340_01894781_01909824 HS2ST1 coding upstream 337164 1894674 ~ 1911359 (-)
G486348 NA non-coding downstream 62631 1494439 ~ 1494642 (-)
G486276 NA non-coding downstream 124602 1432444 ~ 1432671 (-)
G486289 NA non-coding downstream 270342 1286635 ~ 1286931 (-)
G486267 NA non-coding downstream 305309 1250482 ~ 1251964 (-)
G486153 NA non-coding downstream 333818 1213049 ~ 1223455 (-)
G487872 NA non-coding upstream 123850 1681360 ~ 1682396 (-)
G487878 NA non-coding upstream 174533 1732043 ~ 1732280 (-)
G487881 NA non-coding upstream 188727 1746237 ~ 1746499 (-)
G487905 NA non-coding upstream 273292 1830802 ~ 1831023 (-)
G487918 NA non-coding upstream 366768 1924278 ~ 1925429 (-)
CI01000340_00787534_00791061 NA other downstream 765864 786551 ~ 791409 (-)
G485786 NA other downstream 1231557 325334 ~ 325716 (-)
CI01000340_00062787_00080635 NA other downstream 1475178 62780 ~ 82095 (-)
G487884 NA other upstream 338291 1895801 ~ 1902272 (-)
G488782 NA other upstream 2448295 4005805 ~ 4006448 (-)
G488862 NA other upstream 2949686 4507196 ~ 4518120 (-)
CI01000340_04598932_04627160 NA other upstream 3042710 4598714 ~ 4627447 (-)
CI01000340_05321995_05329778 ATG4C other upstream 3763243 5320753 ~ 5330215 (-)

Expression


Co-expression Network