G488104


Basic Information

Item Value
gene id G488104
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 2197737 ~ 2198034 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU560008
GACCCTTACGCACAGAGATTGTTCCAGATTCTCTGAATCTTTGGATGATATTATGCACTGTAGATGATGATAACTTCAAACTCTTTGCAATTTTTCTCTGAGAAACTCCTTTCTGATATTGCTCCACTATTTTTCACCACAGCATTGGGGGAATTGGTGATCCTCTGCCCATCTTGACTTCTGAGAGTAATAAGTTGCAAATTGGTCCTCCAGCTGTTCCTTATATGTACATTTAACTTTTCCGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU560008 True 245 lncRNA 0.40 2 2197737 2198034

Neighbor

gene id symbol gene type direction distance location
CI01000340_02172629_02189732 HDLBP, HDLBPA coding downstream 8005 2171683 ~ 2189732 (-)
CI01000340_02008099_02012700 SOX14.S, SOX14 coding downstream 185037 2008022 ~ 2012700 (-)
CI01000340_01952181_01975472 NA coding downstream 221451 1951515 ~ 1976286 (-)
CI01000340_01916883_01917263 NA coding downstream 280385 1915653 ~ 1917352 (-)
CI01000340_01894781_01909824 HS2ST1 coding downstream 286378 1894674 ~ 1911359 (-)
CI01000340_02293072_02301920 STK25B, STK25, STK25A coding upstream 94980 2293014 ~ 2302947 (-)
CI01000340_02329631_02332000 DTYMK coding upstream 131572 2329606 ~ 2332000 (-)
CI01000340_02333476_02337529 AGXTA coding upstream 135068 2333102 ~ 2337529 (-)
CI01000340_02341068_02348409 NA coding upstream 142469 2340503 ~ 2348477 (-)
CI01000340_02567081_02567521 NA coding upstream 368703 2566737 ~ 2567643 (-)
G488103 NA non-coding downstream 2353 2195110 ~ 2195384 (-)
G488102 NA non-coding downstream 2766 2194700 ~ 2194971 (-)
G488101 NA non-coding downstream 3187 2194326 ~ 2194550 (-)
G488096 NA non-coding downstream 31497 2165992 ~ 2166240 (-)
G487971 NA non-coding downstream 205099 1990574 ~ 1992638 (-)
G488113 NA non-coding upstream 15155 2213189 ~ 2218915 (-)
G488114 NA non-coding upstream 23052 2221086 ~ 2221613 (-)
G488119 NA non-coding upstream 29319 2227353 ~ 2229293 (-)
G488142 NA non-coding upstream 106417 2304451 ~ 2304769 (-)
G487958 NA non-coding upstream 139855 2337889 ~ 2338491 (-)
G487884 NA other downstream 295465 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 1406328 786551 ~ 791409 (-)
G485786 NA other downstream 1872021 325334 ~ 325716 (-)
CI01000340_00062787_00080635 NA other downstream 2115642 62780 ~ 82095 (-)
G488782 NA other upstream 1807771 4005805 ~ 4006448 (-)
G488862 NA other upstream 2309162 4507196 ~ 4518120 (-)
CI01000340_04598932_04627160 NA other upstream 2402186 4598714 ~ 4627447 (-)
CI01000340_05321995_05329778 ATG4C other upstream 3122719 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 3985256 6095704 ~ 6194501 (-)

Expression


Co-expression Network